Explain the failure of endodontic Treatment, Biology

Assignment Help:

Explain the Failure of Endodontic Treatment

1. Microorganisms are left inside the canal

- Improper/inability of cleaning and shaping,

- Source of infection could be: periapically "by persistent bacteria under the apical area"

or coronally "through the coronal restoration".

2. Missed canal, "like the MM: middle mesial canal",

3. Apical ramification "multiple canals at the apical area",

 ** You have to do good irrigation to reach the areas that could not be reach with the instruments!

4. Perforations with post placement

5. Iatrogenic errors "Over or insufficient obturation".

6. Root canal calcification.


Related Discussions:- Explain the failure of endodontic Treatment

Mode of nurition, What mode of nutrition did lizard exihbite

What mode of nutrition did lizard exihbite

How cells of neoplastic tumors obtain oxygen and nutrients, Q. How do cells...

Q. How do cells of neoplastic tumors obtain oxygen and nutrients and release wastes? In the neoplastic tumors a phenomenon called as angiogenesis occurs. The Angiogenesis is th

What are the four groups of protozoans, Q. What are the four groups of prot...

Q. What are the four groups of protozoans? The four main groups of protozoans are the mastigophores flagellated, like the trypanosome that causes Chagas' disease, the sarcodine

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine regulation of ph of body fluids, Blood functions to maintain home...

Blood functions to maintain homeostasis in the human body through all but which of the following: Answer moving carbon dioxide away from cells following completion of aerobic metab

Limitations of ecological pyramids, Limitations of Ecological Pyramids ...

Limitations of Ecological Pyramids The pyramid of energy is a significant improvement over the previous two types of ecological pyramids, yet all of them overlook one or anot

Write a short note on muscular system, Write a short note on muscular syste...

Write a short note on muscular system? The muscular system provides mobility and support to the body. There are three types of muscle tissue: skeletal, smooth, and cardiac. Th

Phylum annilida, how we attempt a question of phylum annilida in exam?

how we attempt a question of phylum annilida in exam?

Determine the luria''s testing methods, Determine the Luria's testing metho...

Determine the Luria's testing methods The choice of using items selected by Christensen to determine Luria's testing methods was, in retrospect, probably less crucial than the

Explain the mortality and survivorship curves, Explain the Mortality and Su...

Explain the Mortality and Survivorship Curves? Mortality : Just as a population has a birth rate, so does it have a death rate. A populations rate of death, or the number of

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd