Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Failure of Endodontic Treatment
1. Microorganisms are left inside the canal
- Improper/inability of cleaning and shaping,
- Source of infection could be: periapically "by persistent bacteria under the apical area"
or coronally "through the coronal restoration".
2. Missed canal, "like the MM: middle mesial canal",
3. Apical ramification "multiple canals at the apical area",
** You have to do good irrigation to reach the areas that could not be reach with the instruments!
4. Perforations with post placement
5. Iatrogenic errors "Over or insufficient obturation".
6. Root canal calcification.
What mode of nutrition did lizard exihbite
Q. How do cells of neoplastic tumors obtain oxygen and nutrients and release wastes? In the neoplastic tumors a phenomenon called as angiogenesis occurs. The Angiogenesis is th
Q. What are the four groups of protozoans? The four main groups of protozoans are the mastigophores flagellated, like the trypanosome that causes Chagas' disease, the sarcodine
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Blood functions to maintain homeostasis in the human body through all but which of the following: Answer moving carbon dioxide away from cells following completion of aerobic metab
Limitations of Ecological Pyramids The pyramid of energy is a significant improvement over the previous two types of ecological pyramids, yet all of them overlook one or anot
Write a short note on muscular system? The muscular system provides mobility and support to the body. There are three types of muscle tissue: skeletal, smooth, and cardiac. Th
how we attempt a question of phylum annilida in exam?
Determine the Luria's testing methods The choice of using items selected by Christensen to determine Luria's testing methods was, in retrospect, probably less crucial than the
Explain the Mortality and Survivorship Curves? Mortality : Just as a population has a birth rate, so does it have a death rate. A populations rate of death, or the number of
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd