Common eye defects, Biology

COMMON EYE DEFECTS -

1.       Glaucoma - Pressure of aquous humour is increased, retina is degenerated.

2.       Presbyopia - Due to non etastic cilliary muscles, image of far and near place is not clear, generally it takes place in old age. Bifocal lens is used.

3.       Toris - Upper eye lid is hanged down due to weakness of muscles.

4.       Irtis - Due to inflamation of iris

5.       Ophthalmitis - Inflamation of iris & cilliary body.

6.       Trichoma - Mainly responsible for blindness. Under eye lids granules are formed. Caused by Chlomidia trachomatis.

7.       Far sightedness or Long sightedness or Hypermetropia - Diameter of eye ball is reduced. Object of far distance can be seen clearly. Near objects are not seen clearly. Focal point is formed behind retina convex lens is used. Jaeger's chart is related to it.

239_common eye defects.png

8.       Near sightedness or myopia - Diameter of eye ball is increased. Near objects can be seen clearly. Far objects are not seen clearly. Focal point is formed before ratina. Concave lens is used. Smellen's chart is related to it.

9.       Ptosis - Falling or droping of eye lids.

10.     Colour blindness - Ishihara's chart is related to it.

Posted Date: 10/3/2012 4:31:32 AM | Location : United States







Related Discussions:- Common eye defects, Assignment Help, Ask Question on Common eye defects, Get Answer, Expert's Help, Common eye defects Discussions

Write discussion on Common eye defects
Your posts are moderated
Related Questions
A diploid cell contains four pairs of homologous chromosomes designated C1 and C2, M1 and M2, S1 and S2, and W1 and W2. Predict the number of different haploid cells that could be

How does the interaction between a carrier protein and the substance it transports resemble the interaction among an enzyme and its substrate? Both include the binding of a spe

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

give two examples of chemical reactions which are catalysed by enzymes in the course of brewing

Acute Renal Failure You know that acute renal failure refers to the sudden deterioration in kidney function, characterised by reduced urine excretion to less than 10 ml/kg  bo


ARTIFICIA L KIDNEY - Dialysis employs the process of diffusion across a semipermeable membrane to remove unwanted urea . Dialysis is of 2 types - 1. Haemodialysis -

Define the Post-Herbal Period? It is difficult to draw a sharp line of demarcation between the transition period, marked by various attempts of classification, all of which we

Q. What is the approximate pH of the salivary secretion? Is it an acid or basic fluid? What are the main functions of saliva? The saliva pH is approximately 6.8 it is therefore

Q. Antimicrobial Barriers -  proliferation of microorganisms? The first barrier is the integument: a physical barrier to protect the food, e.g., the shell on eggs, the skin on