Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Amino acids are the subunits ( or the monomers) from which proteins (polymers) are assembled. Each amino acid comprises of an amino functional group, and a carboxyl acid group, and is different from the other amino acids by the composition of an R group.
Q. Generally which phase of the cell cycle has longer duration? The mitotic phase has quite a shorter length and the interphase comprises approximately 4/5 of the cell cycle.
Use of trichomoniasis in pregnancy Trichomoniasis in pregnancy has been associated with adverse pregnancy outcomes (D Soper, Am J Obstet Gynecol 2004; 190:281). Metronidazole
Taxonomic Hierarchy The sheer complexity of organisms seems so bewildering that some people believe, life to be unfathomable by the rational mind. Biologists constantly chip aw
Determine the name of Material used for BCC You must be interested to know about type of material you can prepare and some material is available in hospitals and clinics for us
Vertical Implant Position: The implant can be submerged in the bone up till the level, where it is surface treated or further embedded till its shoulder, depending upon the sit
ALEURONE GRAINS - Also known as Plant lysosome , because they contain hydrolytic enzymes. Consists of Proteins. They are also known as Aleuroplast because they are ric
what is taxonomy
If carbon 1 is the carbonyl group of a 6-carbon aldose (aldohexose), which carbon determines if the sugar is a D- or L- stereoisomer? Select one: a. 1 b. 2 c. 3 d. 4
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
BASICS OF ENVIRONMENT We live in two world one is natural world of animals, plants, air, water and soil that was present since the evolution of earth. The other world is of soc
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd