Writing return statement in a value returning function

Assignment Help Basic Computer Science
Reference no: EM13166352

What would be wrong with not writing returnstatement in a value returing function? Can you have a returnstatement in a void function? Does the return statement in the following function cause syntax error?

void p(double x, double y)

 

{

cout << x << " " << y << endl;

 

return x+y;

 

}

2. Write a function headers (not the bodies) for the following functions;

a. Return a sales commission, given the sales amount and the commission rate.

 

b.Display the calendar for a month, given the month and year.

 

c.Return a square root of number.

 

d.Test Whether a number is even, and return true if it is.

 

e.Display a message a specified number of times.

 

f.Return the monthly payment, given the loan amount, number of years, and annual interest rate.

 

g.Return the corresponding uppercase letter, given a lowercase letter.

Reference no: EM13166352

Questions Cloud

Identify and correct the errors : Identify and correct the erros in the following program. void nPrintln(string message, int n){int n=1;for (int i=0; i int main (){nPrintln(5, "Welcome to C++!");}
Constructor that accepts a file name as its argument : Write a class with a constructor that accepts a file name as its argument. Assume the file contains a series of numbers, each written on a separate line. The class should read the contents of the file into an array, and then displays the following..
Estimate the radius of the molecules : The critical constants of ethane are Pc = 48.20 atm, Vc = 148 (cm^3)/mol, and Tc = 305.4 K. Calculate the van der Waals parameters of the gas, and estimate the radius of the molecules.
Method summarizesequences that takes a string as a parameter : Now implement the method summarizeSequences that takes a String as a parameter. This method should open the file named by this String, and read a sequence from that file into an array list using the getSequence method you wrote above
Writing return statement in a value returning function : What would be wrong with not writing returnstatement in a value returing function? Can you have a returnstatement in a void function? Does the return statement in the following function cause syntax error?
What are the data entities of this enterprise : Consider a student club or organization in which you are a member. What are the data entities of this enterprise? List and define each entity
Sketch a normal.probability plot to check the normality : If it is a t test, sketch a normal.probability plot to check the normality of the population.6. State the null and alternative hypothesis.7. Decide on the significance level, alpha.
A stack data structure that uses a linked list for storing : In Python, implement a stack data structure that uses a linked list for storing its elements. In particular, you will need to implement the following three functions: 1. top(): This function returns the element that is at the top of the stack, but it..
Direction of greater formal order and abstraction : What pair of painters sought to develop beyond the impressionist style in  the direction of greater formal order and abstraction?

Reviews

Write a Review

Basic Computer Science Questions & Answers

  Installation options for customer tracking system

Which installation options are available for the Customer Tracking System? Which would you recommend? How can you determine if implementation has been successful?

  Sketch a normal.probability plot to check the normality

If it is a t test, sketch a normal.probability plot to check the normality of the population.6. State the null and alternative hypothesis.7. Decide on the significance level, alpha.

  Consider an rgb raster system and color lookup table

Consider an RGB raster system that has a 1024 by 800 frame buffer with 16 bits per pixel and a color lookup table with 24 bits per pixel.

  Describe the different parts of the cia triad

Describe the different parts of the C.I.A. triad and how each can be used to improve the overall security of an information system.

  Distinguish between caching and buffering

Distinguish between caching and buffering The failure model defines the ways in which failure may occur in order to provide an understanding of the effects of failure. Give one type of failure with a brief description of the failure

  Prediction for open standards that may change world again

In April of 1990, entire concept of domain was born, and email addresses "opened up". What might be the prediction about more open standards which may change our world again?

  Describe the five forces model

Describe the Five Forces Model. What role does the Five Forces Model play in decision making? Define a database management system and discuss each of the five important software components of a database management system.

  Explaining health insurance portability-accountability act

Based on your knowledge of IT security management, argue for or against assertions that Epworth system is in compliance with Health Insurance Portability and Accountability Act (HIPAA).

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  When users move the mouse

When users move the mouse over each thumb image of the item, an enlarged picture of the item will appear to the right of the thumb image. For each listed item, you should allow user to specify the numbers he/she intends to buy

  Computing effective cpi of computer

Workstation uses a 15-MHZ processor with claimed 10-MIPS rating to execute a given programme mix. Suppose a one-cycle delay for each memory access. Compute effective CPI of this computer ?

  Differentiate centralised and distributed data processing

Explain the differences between centralised and distributed data processing. Describe the pros and cons of each approach.

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd