Design the logic for a program

Assignment Help Basic Computer Science
Reference no: EM13159814

Using Visual Logic: Design the logic for a program that allows a user to entry 15 numbers, then displays each number and its difference from the numeric average of the numbers entered.

Question: Having trouble firguring out how to add the random 15 numbers.

Reference no: EM13159814

Questions Cloud

How natural selection works on individuals : Include a real or hypothetical example ofthe process of natural selection in your answer other thaninsects and insecticide!Identify the specific natural selection pressure and the specifictrait being selected for in your example.
Explain what is the overall order of the reaction : A reaction in which A,B ,C and react to form products is first order in A, second order in B, and zero order in C. What is the overall order of the reaction?
Struct complex : A complex number can be represented by two parts, real and image. A series complex data can be organized as a group of elements by linked list, which is shown as below: struct Complex
Run in the forward direction to restablish equilibrium : Run in the forward direction to restablish equilibrium. B. Run in the reverse direction to restablish equilibrium. C. Remain the same. Already at equilibrium. The concentration of CO will: A. Increase. B. Decrease. C. Remain the same
Design the logic for a program : Using Visual Logic: Design the logic for a program that allows a user to entry 15 numbers, then displays each number and its difference from the numeric average of the numbers entered.
What is the maximum mass of molybdenum : The elements silver, molybdenum, and sulfur combine to form Ag2MoS4. What is the maximum mass of Ag2MoS4 that can be obtained if 8.63 g of silver
Define and explains an open system : Defines and explains a closed system and provides an example. Defines and explains an open system and provides an example. Explains the inner and outer flows of a closed system. Explains the inner and outer flows of an open system.
How can they benefit from trade with a poor country : Describe how a developing/emerging economy can benefit from trade with a wealthy country even if it has no absolute advantages. How can they benefit from trade with a poor country?
Compute how many moles of ethanol are used : Use a molar mass of 800g/mol for the vegetable oil and use a density of 0.88g/mL for vegetable oil and 0.79 g/mL for methanol to calculate how many moles of ethanol are used.

Reviews

Write a Review

 

Basic Computer Science Questions & Answers

  Information culture have negative impact on apple-s business

Which of the given information cultures would have the greatest negative impact on Apple's business? Information-functional culture, Information-sharing culture.

  Estimate maximum aggregate i-o transfer rate in system

Estimate the maximum aggregate I/O transfer rate in this system. Hint: Only one device at a time can be serviced on a selector channel.

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  Create implementation plan to analyze options

Boardman plans to hire Smith Systems Consulting to help them analyze their options and to create the implementation plan.

  Tools to perform project management processes

Describe in scholarly detail the tools and techniques that are used for prforming project management processes.

  Describe modifications be made to poorly designed website

Discover the site which you feel is poorly designed and describe what modifications must be made using text as a guide.

  Write program to enter two separate numbers

Write a program which would permit a user to enter two separate numbers and choose one of four mathematical operations (add, subtract, multiply, divide).

  Explain sequences of signals that occur on address bus

Explain the sequences of signals that occur on address bus, control bus, and data bus when a simple microcomputer fetches an instruction.

  Explaining statement for security policy

Write a statement for security policy for the following:Let LAN for small 100-person business, Pixel Inc. Business occupies one floor in office building. Everybody has a computer on his or her desk.

  Study evidence for defence in law firm

You are engaged by law firm to study evidence for the defence. You uncover evidence that doesn't help your client's case but was not discovered by the prosecution.

  Design two level and-or and not circuit

Design a two level AND , OR ,NOT circuit for the following I/O priority circuit,when the ack input is true ack will be made true for the smallest j for which req is true.

  How components of computer system interact in system

How do components of computer system interact within system? What improvements or additions to system do you believe would benefit you or make system more user-friendly?

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd