Address the learning outcomes of the assignment

Assignment Help Basic Computer Science
Reference no: EM131178633

Similar to wide-area networks, local-area networks are an example of communication networks interconnecting several devices for information exchange. The LAN design is usually for a single floor or building, but it can also reach to multiple buildings via routers and bridges. The design is shared medium rather than switching nodes. The internal data rates for LANs are greater than for wide-area networks.

SLP 3 reviews sections 12 and 13 of the Data Communication and Networking e-textbook.

SLP 3 Assignment

Submit the answers to the assignment below in a 3- to 4-page Word document.

Exercises 1 and 2 were extracted from Forouzan (2007, p. 465).

  1. What is the hexadecimal (hex) to binary equivalent of the following Ethernet address? What is the equivalent of hex to decimal? Use the https://www.binaryhexconverter.com/ converter for the calculations.
    0101101000010001   0101010100011000    1010101000001111  
  2. Design a system of three LANs with four bridges. The bridges (B1 to B4) connect the LANs as shown below. Show diagram in Word and use any diagramming tool to demonstrate the design (Forouzan 2007, p.465).
    1. B1 connects LAN 1 and LAN 2.
    2. B2 connects LAN 1 and LAN 3.
    3. B3 connects LAN 2 and LAN 3.
    4. B4 connects LAN 1, LAN 2, and LAN 3.
  3. Can we replace the bridge with a router? Explain the consequences.
  4. Which one has more overhead, a bridge or a router? Explain your answer.
  5. Which one has more overhead, a repeater or a bridge? Explain your answer.
  6. Which one has more overhead, a router or a gateway? Explain your answer.

SLP Assignment Expectations

The report should:

  • Demonstrate clear understanding of the subject and address all key elements of the assignment.
  • Show analysis, synthesis, and evaluation of required material.
  • Demonstrate writing proficiency at the academic level of the course; address the Learning Outcomes of the assignment.
  • Use and cite relevant and credible sources to support assertions. The report is well organized and follows the structure of a well-written paper. APA style format is applied for all citations. 

Reference no: EM131178633

Questions Cloud

Estimate the cash flows for the investment : ACC515 - Accounting and Finance - Calculate the value of each investment based on the required rate of return and what required rates of return would make your recommendation indifferent to all three options?
Complete the tower of hanoi puzzle : Use mathematical induction to verify the formula derived in Example 2 for the number of moves required to complete the Tower of Hanoi puzzle
Explain the strength and weaknesses of sdlc models : 1. Explain the strength and weaknesses of SDLC models? 2. Define the term object-oriented analysis and design.
Explain purpose and significance of two operating measures : The difference between two operating measures, net income and cash from operations.- Explain the purpose and significance of these two operating measures.
Address the learning outcomes of the assignment : Demonstrate writing proficiency at the academic level of the course; address the Learning Outcomes of the assignment. Use and cite relevant and credible sources to support assertions. The report is well organized and follows the structure of a well-..
Every nonzero element has a unique multiplicative inverse : This fact enables us to speak of "the multiplicative inverse" rather than "a multiplicative inverse" of a nonzero element in a field.
How would you sell idea of power protection to your client : One of your clients has a problem with electricity. Periodically, the lights flicker or become dim, and many of the personal computers reboot or hang. During these power sags, some users lose data. What is a practical solution to this problem? How..
Data communication and networking e-textbook : The transmission of a data stream from one device to another requires cooperation from all transmitting sites through synchronization. In asynchronous transmissions, each character of data is treated independently, and each byte begins with a star..
Discuss what normalization is and why it is important : Discuss what normalization is and why it is important. Normalize the database design in Module 2, and describe whether the tables are all normalized. Explain whether the tables satisfy the requirements of 1NF, 2NF, and 3NF.

Reviews

Write a Review

 

Basic Computer Science Questions & Answers

  Question regarding the commutative properties

Show that Zmwith addition modulo m, where m ≥ 2 is an integer, satisfies the closure, associative, and commutative properties, 0 is an additive identity, and for every nonzero a ∈Zm, m - a is an inverse of a modulo m.

  Ethics in technology issues

Select one of these Ethics in Technology issues:

  Are k1 and k2 independent events

Are K1 and K2 independent events?

  Explain what type of architecture the new payroll applicatio

Explain what type of architecture the new payroll application should use and why.Identify what types of technology will be involved in the architecture and explain the purpose of each technology.

  How are they same and different

How are they the same? How are they different?

  A local department store hires you to write

A local department store hires you to write an automated checkout program to expedite customers in a hurry. The checkout line can only accept five items for any one purchase. Design a program that asks for the price of each item, and then displays..

  Description of the task the pseudo-code

Select a task a program could perform over an array of items that would be useful. Your task must include the following:

  Complete a truth table for a 1 bit alu with 5 inputs

Complete a truth table for a 1 bit ALU with 5 inputs (A,B,f0,f1,carry in) and two outputs (Output,C_out)

  Identify position-indicate what pattern is found in thread

Thread the sequence AATCGATAAGCAAAACCGGATTACGATATATAT through the tree. If any pattern is found in any position, identify that position and indicate what pattern is found.

  What is the difference between the types of parameters

What is the difference between the types of parameters (explained in Chapter 4) used in methods and the types of values that can be returned from a function?

  What are circular references

What are circular references? Explain how garbage collection deals with circular references.

  Article related to cloud-enabling technology

Find 1 article related to Cloud-Enabling Technology and to turn in the following: (1) TheURL of the article, (2) A brief summary of the article, and (3) a brief statement of your thoughts on the article. These items should be no more than 1 page in l..

Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd