Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Why the orange trees are often sprayed with water?
Although it is grossly counter-intuitive, whenever citrus groves are in risk of experiencing below-freezing temperatures, the trees are sprayed with water. This causes frost to form on the rinds of the fruit and gives an extra layer of insulation against the low temperatures that would or else freeze the edible portion of the fruit and obliterate the crop.
Q. What is an open circulatory system? Open circulatory system is the one in which blood doesn't circulate only inside blood vessels but it also falls in cavities that irrigate
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What are the uses of whey protein concentrates? Whey protein concentrates are used extensively in the manufacture of baked goods, where they increase the effectiveness of short
Q. Can you explain Restrictive Ventricular Septal Defect ? VSD is restrictive when VSD pressure gradient is more than 60mmHg (systolic cuff pressure-VSD lpressure grad
Phylum Ciliophora - Protozoan Simple cilia or compound ciliary organelles typical in at least one stage of life cycle; subpellicular cilia present even if surface cilia are ab
Q. Principal categories in classification? First of all there is a need to know what classification is? Let us define in simple term. Classification is placing of a plant (or g
different types of respiration system in different organisms
a) What conditions do most seeds need in order to begin germination? b) What other condition do the seedlings need to continue growth to mature plants? a) Most seed
The following progeny genotypes were observed: 73 AaBb, 64 aabb, 279 Aabb, 303 aaBb. Using a chi-square test, test whether these two loci show independent assortment? How would
Define Genetic Susceptibility Factors for Obesity? Some people inherit a tendency to become fat. Earlier, it was thought that genetic inheritance ranged from 66% to 80% but now
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd