Why are heterotrophic not classified as plants or animals, Biology

Assignment Help:

Why are heterotrophic, autotrophic , and mixotrophic protists not classified as plants or animals ?


Related Discussions:- Why are heterotrophic not classified as plants or animals

Diagnostic procedures for acute glomerulonephritis, Diagnostic Procedures ...

Diagnostic Procedures     Taking Clinical history    Urine analysis    Blood sample  for  estimation  of blood urea nitrogen    Antistrepto lysine  (ASO) titer

Centrifugal pump-type of blood pump, Centrifugal Pump: This is available ...

Centrifugal Pump: This is available for clinical perfusion from 1976 (Bio Medicus Pump). It is disposable, causes less blood trauma and reduces the risk of massive air embolism.

In which condition number of white blood cell decreases, The condition in w...

The condition in which there is a DECREASE in the number of white blood cells in humans is termed as: a) Leukocytosis (pron: lew-kO-sigh-toe-sis) b) Leukopenia (pron: lew-kO

Define the ltlt pasteurization method, Define the LTLT Pasteurization Metho...

Define the LTLT Pasteurization Method? In LTLT pasteurization, the pasteurization time is in the order of minutes and related to the temperature used; two typical temperature/t

How can nutrients are classified, Q. According to their functions how can n...

Q. According to their functions how can nutrients are classified? One possible and utile functional classification for nutrients is the one that separates them into energetic,

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

List the requirements of implant materials, List the requirements of implan...

List the requirements of implant materials. a) Biologically compatibility: an ideal implant material will elicit mainly physiological reactions within the surrounding tissues (

Zoogly, are protozoans primitive to life .

are protozoans primitive to life .

Complications in celiac disease, Q. Complications in celiac disease? Pa...

Q. Complications in celiac disease? Patients with severe form of celiac's disease for long period are at risk for several complications mainly due to nutrient absorption probl

Define drug effects on food intake - cause dry mouth, Define drug effects o...

Define drug effects on food intake - cause dry mouth? cause dry mouth (xerostomia) : Lack of saliva makes it difficult to masticate and swallow foods, especially those of a dry

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd