Which chemical causes tooth destruction, Biology

Assignment Help:

The bacteria that cause dental cavities in humans break down sugars, releasing what chemical which causes tooth destruction?

a) Acids

b) Bases

c) Enzymes

d) Monosaccharides

Answer: a - acids

 


Related Discussions:- Which chemical causes tooth destruction

Renin-angiotensin system, As heart failure sets in, there is activation of ...

As heart failure sets in, there is activation of RAS (Fig 2.1). Adrenergic stimulation of beta-1 receptors in juxtaglomerular apparatus of the kidneys results in release of renin.

Relaxin - reproduction, Normal 0 false false false EN-I...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Classification of multicellular animals - coelom, Classification of Multice...

Classification of Multicellular Animals - Coelom We know earlier that the pseudocoel gave animals specific selective benefits. Among other things, this fluid-tilled space wor

What are taenias, What are taenias? What are the diseases caused by them? ...

What are taenias? What are the diseases caused by them? Taenias, also called as tapeworms, are platyhelminth animals (flatworms). The major diseases caused by taenias are taeni

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How are the male gametes of gymnosperms formed, Q. How are the male gametes...

Q. How are the male gametes of gymnosperms formed? What is the relationship between the pollen grains and the concept of alternation of generations? In the male strobiles (cone

Aschelminthes, General characters of aschelminthes

General characters of aschelminthes

1, what are the alpha taxonomy?

what are the alpha taxonomy?

Apical ectodermal ridge or aer, Apical Ectodermal Ridge (AER) We have ...

Apical Ectodermal Ridge (AER) We have described earlier that the AER persists at the tip until the last phalangeal cartilage begins differentiation. The following experiments

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd