Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is the pH inside the stomach? Why is there a need to keep that pH level? How is it maintained? Which are the cells that produce that pH?
The normal pH of the gastric juice is around 2 so it is an acid pH.
It is necessary for the gastric pH to be kept acid for the activation of pepsinogen (a proenzyme secreted by the gastric chief cells) into pepsin the digestive enzyme that acts only under low pH This pH level is attained by the secretion of hydrochloric acid (HCl) by the parietal cells.
Coverage of Ecology AND Evolution to include: Ecology Impact of HTC and/or IRC on chemical usage and the ecological and/or evolutionary impact of the chemical usage
Concept of Production - Ecosystems The ecosystems are unable to function, unless there is a constant input of energy from an external source that is sun. Solar energy enters t
Umbilical Hernia: An umbilical hernia is protrusion of a portion of intestine through the umbilical ring (an opening in the muscular area of the abdomen where the umbilical
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q What is the morphological feature of molluscs after which the phylum is named? The word "mollusc" imply "soft thing". Molluscs have soft bodies and this feature describes the
Give an example of how the public perception of science has been distorted or manipulated to serve an alternative purpose.
Q. What are the major events of the first mitotic period? The first mitotic period is the prophase. During prophase the following events occur migration of each centriole pair
P a r a s i t i c Diseases F a s cioliasis It is a liverfluke infestation characterized by hepatic insufficiency, bile duct obstruction, and poor production per
Iron Iron is an essential component of the proteins involved in oxygen transport or utilization. These proteins, including hemoglobin, myoglobin and a number of cytochrome and
What are the main functions of (a) the basal (Malpighian) layer, (b) the cornified layer of the skin? (a) The basal (Malpighian) layer makes new skin cells and the pigment
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd