What is the optimum temperature for catalyses, Biology

Assignment Help:

What is the optimum temperature for catalyses?

For any chemical reaction, the reaction rate enhances with temperature, so the higher the temperature, the faster the rate. For any enzymatic reaction, the reaction rate will enhance with temperature unless the temperature at which the enzyme starts to denature is reached, and this is the optimum temperature.

The denaturizing temperature depends on the composition of the protein (its amino acid sequence), which differs for catalyses from different organisms. Therefore, the answer to your question is that the optimum temperature is dependent on the source organism.

 


Related Discussions:- What is the optimum temperature for catalyses

Codominance, explain the genotypes for each blood type and how this is an e...

explain the genotypes for each blood type and how this is an example of codominance. Blood type- A, AB, B, 0

How to removes hydrogen from fatty acids, Suppose you treated butter with a...

Suppose you treated butter with a fatty acid desaturase, an enzyme that removes hydrogen from fatty acids and creates double bonds. What would happen?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What does secondary productivity in an ecosystem indicate, a) What does sec...

a) What does secondary productivity in an ecosystem indicate? b) List any two factors by which productivity is limited in aquatic ecosystems

Natality rate - natality, Natality Rate - Natality Natality rate or bi...

Natality Rate - Natality Natality rate or birth rate is determined by dividing the number of individuals born by unit time and is expressed as follows: Natality rate =  ΔNn

When aflatoxigenic molds can occur, Q. When Aflatoxigenic molds can occur? ...

Q. When Aflatoxigenic molds can occur? Occurrence: Aflatoxigenic molds can occur in warmer parts of the world and aflatoxicosis maybe produced in a wide range of tropical and s

Compound feed prepration, Compound feed prepration The compounding of anim...

Compound feed prepration The compounding of animal feed involves processing and blending of raw feed ingredients of wide ranging physical, chemical and nutritional composition int

Illustrate the categories of alloplastic implant materials, Categories of a...

Categories of alloplastic implant materials The entire groups of possible alloplastic implant materials, regardless of their clinical applications fall into the following categ

Explain about vascular cambium, How can the age of a tree be estimated from...

How can the age of a tree be estimated from the analysis of the rings present on a cross section of its stem? For the growth of the tree it is essential to have formation of ne

What are pioneer species, What are pioneer species? What is the role of the...

What are pioneer species? What is the role of the pioneer species? Pioneer species are those first species that colonize places where before there were no living beings, like,

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd