What is the difference between dna and rna, Biology

Assignment Help:

Concerning their biological function what is the difference between DNA and RNA?

DNA is the source of information for RNA production (transcription) and therefore for protein synthesis. DNA is still the basis of heredity due to its replication capability.

The messenger RNA is the template for protein synthesis (translation). In this process tRNA and rRNA also participate as the first carries amino acids for the polypeptide chain formation and the second is a structural constituent of ribosomes (the organelles where proteins are made).

 


Related Discussions:- What is the difference between dna and rna

Enumerate the failures in adaptation, Enumerate the Failures in adaptation ...

Enumerate the Failures in adaptation Failures in adaptation, such as poor school performance or unsatisfactory peer relationships are usually problems that bring children to th

Feeding habit, what is the mode nutrition exibited by tape worm?

what is the mode nutrition exibited by tape worm?

Pulmonary regurgitation, Pulmonary Regurgitation :  Most of the clinical c...

Pulmonary Regurgitation :  Most of the clinical cases are after balloon valvotomy or surgical valvotomy using a trans annular patch. It can be quantified by Echocardiography and D

How different are the actions of antibodies against bacteria, How different...

How different are the actions of antibodies against bacteria and against virus? Why is the cellular immune response activated in case of chronic viral infection? The antibodies

Determine the major demographic processes, Determine the major demographic ...

Determine the major demographic processes? There are five major demographic processes, which are continually at work within the population namely, fertility, mortality, marriag

Kinase, A kinase is in general an enzyme which catalyzes the transfer of th...

A kinase is in general an enzyme which catalyzes the transfer of the phosphate group from ATP to something else. In the molecular biology, it has acquired the more specific verbal

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How cultural practices are effective at limiting disease, Give two cultural...

Give two cultural practices (not chemical) you could use to control black spot of rose. Based on your current knowledge of the disease triangle, why do you think these cultural pra

Passage of pollen tube, Passage of Pollen Tube In cotton, the pollen p...

Passage of Pollen Tube In cotton, the pollen produces a tube within an hour which grows on the surface of the stigmatic hairs, and then between the cells of the stigma at the

State the jackson coleman and fischer theory, Jackson Coleman and Fischer T...

Jackson Coleman and Fischer Theory Jackson Coleman Theory: During accommodation the ciliary muscle contraction causes an anterior thrust of the vitreous. This vitreous thrust p

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd