Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Concerning their biological function what is the difference between DNA and RNA?
DNA is the source of information for RNA production (transcription) and therefore for protein synthesis. DNA is still the basis of heredity due to its replication capability.
The messenger RNA is the template for protein synthesis (translation). In this process tRNA and rRNA also participate as the first carries amino acids for the polypeptide chain formation and the second is a structural constituent of ribosomes (the organelles where proteins are made).
Enumerate the Failures in adaptation Failures in adaptation, such as poor school performance or unsatisfactory peer relationships are usually problems that bring children to th
what is the mode nutrition exibited by tape worm?
Pulmonary Regurgitation : Most of the clinical cases are after balloon valvotomy or surgical valvotomy using a trans annular patch. It can be quantified by Echocardiography and D
How different are the actions of antibodies against bacteria and against virus? Why is the cellular immune response activated in case of chronic viral infection? The antibodies
Determine the major demographic processes? There are five major demographic processes, which are continually at work within the population namely, fertility, mortality, marriag
A kinase is in general an enzyme which catalyzes the transfer of the phosphate group from ATP to something else. In the molecular biology, it has acquired the more specific verbal
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Give two cultural practices (not chemical) you could use to control black spot of rose. Based on your current knowledge of the disease triangle, why do you think these cultural pra
Passage of Pollen Tube In cotton, the pollen produces a tube within an hour which grows on the surface of the stigmatic hairs, and then between the cells of the stigma at the
Jackson Coleman and Fischer Theory Jackson Coleman Theory: During accommodation the ciliary muscle contraction causes an anterior thrust of the vitreous. This vitreous thrust p
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd