What is maturation and adaptation, Biology

Assignment Help:

Maturation and adaptation: (18 to 54 weeks)

The final stage involves maturation and adaptation of the implant-bone interface, peri-implant bone and the entire implant supporting skeletal element. This process continues for years or during entire lifetime of implant. Remodeling is influenced by mechanical, metabolic and age related factors. The excess endosteal and periosteal callus is resorbed and stronger bone structures develop in regions under higher strain. If remodeling is not stimulated by loading, or if the rate of bone formation decreases with age, a negative turnover in bone mass just as in osteoporosis is the\ result.

After excessive interfacial remodeling (due to increased resorption or reduced formation of new bone), the bone-implant contacts can not withstand overloading, and direct bone-implant apposition is prevented by relative motion of the implant. As in inadequate primary implant stabilization during initial healing phase or during premature overloading, a layer of fibrous connective tissue develops around the implant. This resultant peri-implant radiolucency indicates the first sign of implant loosening

 


Related Discussions:- What is maturation and adaptation

Inorganic substances, INORGANI C SUBSTANCES They are small, simple, lo...

INORGANI C SUBSTANCES They are small, simple, low molecular weight substances which are made of elements other than Carbon and Hydrogen combined together. Inorganic substan

State the types of bone density, State the types of bone density Misch ...

State the types of bone density Misch classified bone density into following types (1988) D1. Dense cortical bone- which is almost never observed in maxilla and approximatel

Preparation of icu after surgery, Preparation of ICU Cardiac surgical ...

Preparation of ICU Cardiac surgical ICU is generally connected to the operation theatre so that the patient can be wheeled into the ICU after surgery and also to wheel back

Advantage & disadvantage of using algae as source of protein, Define Advant...

Define Advantage & disadvantage of using Algae as source of protein? Advantage Produces proteins which have almost all the Essential Amino acids. Rich in tyrosine

Thumb rule for dietary management, Q. Thumb rule for dietary management? ...

Q. Thumb rule for dietary management? The thumb rule for dietary management is to advice the patient to try to cut down or avoid:  Red meats. Organ meats such as br

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is radiographic assessment, What is Radiographic Assessment Radio...

What is Radiographic Assessment Radiographic Assessment: Radiographic examination is very different with implants than with teeth. Radiographs are frequently used in implant

How cholera is generally spread in humans, How cholera is generally spread ...

How cholera is generally spread in humans Associated Foods: Cholera is generally a disease spread by poor sanitation, resulting in contaminated water supplies. Sporadic cases o

Culture negative endocarditis, In patients who have not received prior anti...

In patients who have not received prior antibiotics and who will ultimately have blood culture positive endocarditis, it is likely that 95 - 100 per cent of all cultures obtained w

The fragility of erythrocytes, The fragility of erythrocytes The fragil...

The fragility of erythrocytes The fragility of erythrocytes is impaired in the absence of NADPH generation due to the deficiency of glucose-6-phosphate dehydrogenase thereby ca

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd