Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What is arterial switch operation explain briefly?
Arterial Switch Operation: Switching the Great arteries to restore the normal Ventriculoarterial connections. The coronary arteries also need to be transferred the process which is the most delicate part of the surgery. This operation is also called anatomical correction as the normal anatomy is restored. Long-term results are the best with this form of surgery. In cases where there is no large VSD or PDA this operation is best done at birth or within 2 to 3 weeks of age at the most.
Better coal should have following characteristics (1) It should have high calorific value. (2) It should have low moisture content. (3) It should have low ash conte
Patters of Cleavage In most of the animal groups with spherical or almost spherical egg and little or moderate amount of yolk (micro-or mesolecithal eggs), the first and seco
What is a pigment? Scientifically, a chemical that can impart colour and is insoluble in the solvent in which it is used, is referred to as a 'pigment'. Well, you would agree
Buccal Perforations Buccal concavities in the bone can result in some threads of the implant being exposed. Where these are very circumscribed and covered with thick and well-
notochotr is absent in the group ...........
general characteristics of phylum chordata
Q. What is hypertension? The Hypertension is a disease in which the arterial blood pressure, during systole or during diastole, is abnormally high. The Hypertension, or high
How does phosphocreatine act in the muscle contraction and relaxation? Phosphocreatine is the main means of energy storage of the muscle cells. During relaxed periods ATP mo
what is the difference between fair skin and dark skin?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd