What is aquatic biodiversity, Biology

Assignment Help:

Q. What is aquatic biodiversity?

Biodiversity found on Earth today is the result of 3.5 billion years of evolution. Until the emergence of humans, the Earth supported more biodiversity than in any other period in geological history. Since the advent of humans, however, biodiversity has begun a rapid decline, with one species after another suffering extinction. Estimates of global species diversity vary from 2 million to 100 million species, with a best estimate to somewhere near 12.5 million.

New species are regularly discovered (on an average about three new species of birds each year) and many, though discovered, are not yet classified (an estimate gives that about 40% of freshwater fishes from South America are not classified yet). Most of the diversity is found in tropical forests.


Related Discussions:- What is aquatic biodiversity

How different are animal cells from plant cells, Q. How different are anima...

Q. How different are animal cells from plant cells? While plant cells are eukaryotic, photosynthetic, autotrophic and have chloroplasts and cell wall, the animal cells are hete

Define the nutritional shortcomings among the elderly, Define the Nutrition...

Define the Nutritional shortcomings among the elderly? Nutritional shortcomings are common among the elderly; most often due to poor choice of foods i.e. they may be consuming

Define the effect of scfa on sodium absorption, Define the effect of SCFA o...

Define the effect of SCFA on Sodium Absorption? SCFAs (short chain fatty acids) have a stimulatory effect on sodium absorption from colonic lumen. The unionized SCFA crosses th

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe uncontrolled mitotic procedure, Q. What is the uncontrolled mitoti...

Q. What is the uncontrolled mitotic procedure that occurs as disease in pluricellular beings called? Uncontrolled mitotic cell division is known as neoplasia. Neoplasia the for

Why that property of water is important to life, Choose one property of wat...

Choose one property of water and explain why that property is important to life.

Surgical endodontic & retrograde sealing of immature root, Conventional End...

Conventional Endodontic Treatment Surgical Endodontic & Retrograde sealing of Immature root Apex: After cleaning and shaping of the RC and before filling , I make a surgical

Multiple membrane-spanning proteins, Various integral proteins have multipl...

Various integral proteins have multiple membrane-spanning   -helices. Bacteriorhodopsin, a protein found in a photosynthetic bacterium captures the energy from light and uses it to

Impediments to infuse biology - lack of trained people, Define Impediments ...

Define Impediments to infuse biology - Lack of trained people? At present, biologists as a rule have not been trained sufficiently in quantitative approaches. A heavy dose of m

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd