Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What do ypu know about Conduction Disturabances?
During exercise there is an increase in the sympathetic drive and a withdrawal of vagal tone. Sympathetic enhancement of conduction is mediated somewhat by the increased sinus firing rate causing an increased number of impulses arriving at the atrioventricular (AV node). The fatigue of the conduction tissue as a result of the increase traffic and a relatively greater segment of the conduction time being occupied by the refractory period may mitigate the effect of the excess sympathetic influence. In CAD patient, ischaemia may also alter the conduction process, depending on the severity and location. In normal individuals, the PQ interval shortens to about 110 msec.
Gregor Mendel's Law of Independent Segregation referred to which of the following genetic elements? A. Alleles of two genes that reside on the similar chromosome B. Alleles
Use of Beta-blockers : In some centres, patients are routinely put on beta-blockers after CABG. European coronary artery surgery study showed that only 25 per cent of patient
Inter-relationships of Classification The aim of classification is to put together organisms on the basis of their similarities. But the question is what type of similarities?
Determine the Symptoms of Shigellosis Symptoms: Pathogenicity involves the release of lipopolysaccharide endotoxin, which infects the intestinal mucosa. Shigellosis ranges fro
What are the pancreatic tissues involved respectively in the exocrine and endocrine secretions? What are their respective hormones and enzymes? The exocrine secretion of the pa
What is enzyme kinetics The study of the rate at which an enzyme works is called enzyme kinetics.
A genomic DNA library is made from the genomic DNA of an organism. For instance, a mouse genomic library could be made by digesting mouse nuclear DNA with a restriction nuclease to
State the concept of Finger Tapping The subject is asked to tap his or her extended index finger on a typewriter key attached to a mechanical counter. Several series of 10-seco
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Tissue Level - Level of body organization As you know a tissue is a group of cells similar in origin and structure that perform a specific function. The next level, is the tis
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd