What do ypu know about conduction disturabances, Biology

Assignment Help:

Q. What do ypu know about Conduction Disturabances?

During exercise there is an increase in the sympathetic drive and a withdrawal of vagal tone. Sympathetic enhancement of conduction is mediated somewhat by the increased sinus firing rate causing an increased number of impulses arriving at the atrioventricular (AV node). The fatigue of the conduction tissue as a result of the increase traffic and a relatively greater segment of the conduction time being occupied by the refractory period may mitigate the effect of the excess sympathetic influence. In CAD patient, ischaemia may also alter the conduction process, depending on the severity and location. In normal individuals, the PQ interval shortens to about 110 msec.


Related Discussions:- What do ypu know about conduction disturabances

Gregor mendel''s law of independent segregation, Gregor Mendel's Law of Ind...

Gregor Mendel's Law of Independent Segregation referred to which of the following genetic elements? A. Alleles of two genes that reside on the similar chromosome B. Alleles

Use of beta-blockers-peri operative problems, Use of Beta-blockers :  ...

Use of Beta-blockers :  In some centres, patients are routinely put on beta-blockers after CABG. European coronary artery surgery study showed that only 25 per cent of patient

Inter-relationships of classification, Inter-relationships of Classificatio...

Inter-relationships of Classification The aim of classification is to put together organisms on the basis of their similarities. But the question is what type of similarities?

Determine the symptoms of shigellosis, Determine the Symptoms of Shigellosi...

Determine the Symptoms of Shigellosis Symptoms:  Pathogenicity involves the release of lipopolysaccharide endotoxin, which infects the intestinal mucosa. Shigellosis ranges fro

What are exocrine respective hormones and enzymes, What are the pancreatic ...

What are the pancreatic tissues involved respectively in the exocrine and endocrine secretions? What are their respective hormones and enzymes? The exocrine secretion of the pa

What is enzyme kinetics, What is enzyme kinetics The study of the rate ...

What is enzyme kinetics The study of the rate at which an enzyme works is called enzyme kinetics.

Genomic dna libraries , A genomic DNA library is made from the genomic DNA ...

A genomic DNA library is made from the genomic DNA of an organism. For instance, a mouse genomic library could be made by digesting mouse nuclear DNA with a restriction nuclease to

State the concept of finger tapping, State the concept of Finger Tapping ...

State the concept of Finger Tapping The subject is asked to tap his or her extended index finger on a typewriter key attached to a mechanical counter. Several series of 10-seco

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Tissue level - level of body organization, Tissue Level - Level of body org...

Tissue Level - Level of body organization As you know a tissue is a group of cells similar in origin and structure that perform a specific function. The next level, is the tis

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd