What are the main arguments that favor evolutionism, Biology

Assignment Help:

In the scientific competition against fixism what are the main arguments that favor evolutionism?

The major arguments in favor of evolutionism are: paleontological, from the study of similarities among fossils of dissimilar periods; of compared anatomy, the existence of structures with similar origin and function and of residual organs, as the human appendix, that reveal relationships between species; of compared embryology, similarities of structures and developmental processes between embryos of related species; of molecular biology, larger percentage of same nucleotide sequences in the DNA of species having common ancestors.

 


Related Discussions:- What are the main arguments that favor evolutionism

How simple transposition of the great arteries present, How Simple Transpos...

How Simple Transposition of the Great Arteries Present after 30 Days ? A switch operation will have poor results, as the ventricle that has regressed will not be able to mainta

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the term- loss-of-function mutation, Where would a predicted silent...

Where would a predicted silent mutation have to be situated to actually result in a loss-of-function mutation (and potentially lead to the onset of disease)? A. Intron-exon jun

What are the aerobic and anaerobic exercises, Aerobic and Anaerobic Exercis...

Aerobic and Anaerobic Exercises Generally, there are two types of exercises: - Aerobic - Anaerobic Aerobic exercises are those in which the patient spends calories fro

Define methods of quantitative analysis and colorimetry, Define Methods of ...

Define Methods of Quantitative Analysis and Colorimetry? Many methods of quantitative analysis are based upon the production of coloured solutions in such a way that the intens

Precaution - separation of amino acid by paper chromatogrphy, Define Precau...

Define Precaution for Separation of Amino Acids by Paper Chromatography? 1. Hold the paper with the extra strip kept at one side. Handling of whatman paper with hand should be

What are the signs used in acute pericarditis, Q. What are the Signs used i...

Q. What are the Signs used in acute pericarditis? • Pericardial friction rub is pathognomonic of pericarditis. It is heard as a phasic scatching sound. It may vary with phases

External features of human heart, External features of human heart H...

External features of human heart Human heart is a muscular, hollow organ situated slightly towards left side of the thorasic cavity. It is made up of special muscles call

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd