Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are the lethal genes?
The Lethal genes are genes having at least one allele that, while present in the genotype of an individual, causes death. There are dominant lethal alleles and recessive lethal alleles. (There are as well genes having alleles that are dominant when in heterozygosity but lethal when in homozygosity that is the dominance related to the phenotype does not correspond to the dominance related to lethality.)
Elaborates Congenital Aortic Stenosis in details? More common in males (4: 1). High incidence of Bicuspid Aortic valve. Murmur present from early infancy and sometimes at birth
Polyarthritis 1) Gonococcal - Therapeutic trial of pencillin may help in diagnosis of gonococcal infection. 2) Viral infections such as rubella and hepatitis B may have
Q What are the three major types of nitrogen wastes excreted by living beings? The main nitrogen wastes excreted by living beings are ammonia, urea and uric acid. Living beings
Darwin put fort the notion of the survival of the fittest. How do we define 'fittest'? The answer usually given is those who survive. So you can readily see that this is a circular
Maintenance in the Continuing Care Cycle Impaired dexterity: Any impairment of dexterity, even if it is temporary, may be detrimental to dental implants because home maintena
Could any of the following features be useful in a gateway vector; (i) Origin of replication (ii) multiple cloning site (iii) blue/white selection (iv) M13 forward and rev
Define about the Yeast - Saccharomyces? Classification Kingdom - Mycetae Division - Amastigomycota Class - Ascomycetes Order - Endomycetales Family - Saccharomyc
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Cytoplasmic Reorganisation Meiosis is also associated with major reorganisation of the cytoplasm of MMCs and microspores. Microspore mother cell shows high metabolic activity.
what is mitotic apparatus
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd