What are the genotypes, Biology

Assignment Help:

What are the genotypes and respective blood types of the ABO system?

Since the alleles are IA, IB and i the possible genotypes are IAIA (blood type A), IAIB (blood type AB), IBIB (blood type B) and ii (blood type O)

 


Related Discussions:- What are the genotypes

What is the goal of biological classification, The goals of biological clas...

The goals of biological classification The world of animal diversity is quite complex and it requires an ability to recognise similarities and differences among organisms. Class

Poultry and duck diseases-ranikhet disease, Ranikhet disease Ranikhet ...

Ranikhet disease Ranikhet disease, also known in the west as Newcastle disease, is a contagious and highly fatal disease of fowls caused by a virus of the genus Rubulavirus in

What is xaxim, What is xaxim? Most pteridophytes have subterraneous ste...

What is xaxim? Most pteridophytes have subterraneous stems similar to the substrate called as rhizomes. Xaxim is a kind of pteridophyte with an aerial stem in generally perpend

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Harmons, which was the first harmone discovered#

which was the first harmone discovered#

What is the procedure of normal saline dressing, What is the Procedure of N...

What is the Procedure of Normal saline dressing 1. First collect the supplies near the patient. Place should be clean with good lighting where it is easy to work. Use a newspap

Epithelial cells of the kidney proximal tubule, Which of the following is t...

Which of the following is true for the epithelial cells of the kidney proximal tubule? A. The sodium-glucose co-transporter in the luminal membrane is responsible for the net f

Digestion, Adsk question #Minimum 100 words accepted#saliva enzyme

Adsk question #Minimum 100 words accepted#saliva enzyme

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd