Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q What are the bacteriophages?
Bacteriophages are viruses specialized in parasitism of bacteria. They are used in genetic engineering as molecular cloning vehicles to include recombinant DNA into bacteria they were also used in the former Soviet Union to treat bacterial infections.
Bacteriophages have a polyhedron-like capsid and DNA as genetic material, the "head" of the virus is connected to a tail that ends in small fibers that help the virus to attach to the bacterial cell wall and to inject its genetic material into the host.
Hydrops amnii (Hydramnios) Hydramnios is a rare condition. Excessive accumulation of amniotic fluid can be the result of foetal dysgenesis and agenesis. The increase of amniot
1,352,000
Q. What is Rounded ST Depression? A rounded ST-segment depression pattern in the CM5 lead, as well as in the other leads, is common and is often associated with ischaemia. This
I WANT JOB FOR TEACHING SCINCE SUBJECT FOR ONLINE
What are the results of Atrial Septal Defect ? Mortality for ASD closure has approached 0 per cent in most cardiac surgery centers. Late survival of patients who has ASD closu
Explain the Assessment of Zn Status? Sensitive indices for assessing zinc status are unknown at present. Static indices, such as zinc concentration in plasma, blood cells and h
What are the result of Arterial Switch operation ? The operation is highly specialised. When carried out in experienced centers the mortality for simple TGA and TGA with VSD i
What is molecular weight? Molecular Weight : The molecular weight of a molecule refers to the sum of the atomic weights of all the atoms making up the molecule. The gram mol
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Artificial Inspiration : a. After artificial expiration, the rescue worker should slowly release the pressure on the back of the victim. b. This will cause the chest cavity t
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd