What are the bacteriophages, Biology

Assignment Help:

Q What are the bacteriophages?

Bacteriophages are viruses specialized in parasitism of bacteria. They are used in genetic engineering as molecular cloning vehicles to include recombinant DNA into bacteria they were also used in the former Soviet Union to treat bacterial infections.

Bacteriophages have a polyhedron-like capsid and DNA as genetic material, the "head" of the virus is connected to a tail that ends in small fibers that help the virus to attach to the bacterial cell wall and to inject its genetic material into the host.


Related Discussions:- What are the bacteriophages

Female reproductive disorders-hydramnios, Hydrops amnii (Hydramnios) H...

Hydrops amnii (Hydramnios) Hydramnios is a rare condition. Excessive accumulation of amniotic fluid can be the result of foetal dysgenesis and agenesis. The increase of amniot

What is rounded st depression, Q. What is Rounded ST Depression? A roun...

Q. What is Rounded ST Depression? A rounded ST-segment depression pattern in the CM5 lead, as well as in the other leads, is common and is often associated with ischaemia. This

SCINCE, I WANT JOB FOR TEACHING SCINCE SUBJECT FOR ONLINE

I WANT JOB FOR TEACHING SCINCE SUBJECT FOR ONLINE

What are the results of atrial septal defect, What are the results of Atria...

What are the results of Atrial Septal Defect ? Mortality for ASD closure has approached 0 per cent in most cardiac surgery centers. Late survival of patients who has ASD closu

Explain the assessment of zn status, Explain the Assessment of Zn Status? ...

Explain the Assessment of Zn Status? Sensitive indices for assessing zinc status are unknown at present. Static indices, such as zinc concentration in plasma, blood cells and h

What are the result of arterial switch operation, What are the result of Ar...

What are the result of Arterial Switch operation ? The operation is highly specialised. When carried out in experienced centers the mortality for simple TGA and TGA with VSD i

What is molecular weight, What is molecular weight? Molecular Weight ...

What is molecular weight? Molecular Weight :  The molecular weight of a molecule refers to the sum of the atomic weights of all the atoms making up the molecule. The gram mol

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Artificial inspiration, Artificial Inspiration : a. After artificial exp...

Artificial Inspiration : a. After artificial expiration, the rescue worker should slowly release the pressure on the back of the victim. b. This will cause the chest cavity t

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd