What are hexoses, Biology

Assignment Help:

What are hexoses? What are some examples of hexoses with important biological functions?

Hexoses are carbohydrates made of six carbons. Glucose, fructose and galactose are instance of hexoses. Hexoses have an significant biological role as energy sources for the metabolism.

Carbohydrates Properties Review - Image Diversity: fructose molecule sucrose molecule

 


Related Discussions:- What are hexoses

Cation saturation and nutrient absorption by plants, Cation Saturation and ...

Cation Saturation and Nutrient Absorption by Plants The availability of adsorbed cations is not always so easy as the above explanation might suggest. This is because, several

Nutritional management for gastro oesophageal reflux disease, Q. Nutritiona...

Q. Nutritional Management for gastro oesophageal reflux disease? As mentioned above the nutrient requirements remain the same as per the RDI for most patients. It would be impo

Procedure of radiographic template, Procedure of radiographic template ...

Procedure of radiographic template It is very similar to a flasking procedure. Mix slow setting irreversible hydrocolloid (alginate) with cold water (to gain more working ti

Explain the equilibrium dialysis, Explain the Equilibrium Dialysis? Equ...

Explain the Equilibrium Dialysis? Equilibrium dialysis is a useful technique for studying the binding of a small uncharged solute species (a ligand) to a macromolecule. The mac

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Drugs for hepatitis b, Drugs for hepatitis B Chronic HBV infection is ...

Drugs for hepatitis B Chronic HBV infection is currently treated with interferon alfa, lamivudine or adefovir. Lamivudine is much better tolerated than interferon and much les

What is angiosperms, What is Angiosperms? Angiosperms are the second ma...

What is Angiosperms? Angiosperms are the second major group of plants that bear seeds. Angiosperms (seeds in vessels) differ from gymnosperms in that their seeds develop within

Skeletal system - girdles, GIRDLES - (i ) PECTORAL GIRDLE - ...

GIRDLES - (i ) PECTORAL GIRDLE - 4 bones. It is located on posterolateral part of upper region of the throax. It consists of scapula & clavicle. Scapula is placed

Will any cell verify the cell theory, Of the cell types observed (Parameci...

Of the cell types observed (Paramecium, Euglena, Yeast, Elodea, cheek cells), would any cell "verify" the cell theory? Explain your answer.

Anther, parts and functions of the anther

parts and functions of the anther

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd