Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are enzyme cofactors?
Some enzymes require other associated molecules to work. These molecules are known as enzyme cofactors and they can be, for example, organic ions like mineral salts, or organic molecules.
Inactive enzymes which are not bound to their cofactors are known as apoenzymes. Active enzymes bound to their cofactors are known as holoenzymes.
KA R YOTYPE External morphology of Chromosomes specific for each species of living organisms. Karyotype can be studied in metaphase of mitosis. Karyotype includes th
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
a) The image above is part of a DNA sequencing gel. Assuming this is the DNA coding strand and you are reading 5' -> 3' what are ALL the possible polypeptides this sequence cou
Amylase The presence of pancreatic amylase brings about the breakdown of starch and glycogen and its action is similar to salivary amylase. The hydrolysis of starch and gl
Determine the term Clade? In cladistic taxonomy, how groups of animals are related to each other. It includes the ancestral group and all of the other groups, or lineages, of a
Define the functional properties of hydrocolloids The hydrocolloids not only have the functional properties but also have nutritional characteristics. Most polysaccharide gums
Use of repellents Avoidance and early removal of ticks are the first steps in prevention of Lyme disease. In highly endemic areas, when an engorged Ixodes scapularis tick is at
assignment of digestive gland
Bergmann's Method of Cell Plating In this method free cells are suspended in a liquid medium at a density twice the finally desired plating density. Melted agar containing med
What are trophic levels? How many trophic levels can a food chain have? The Trophic levels correspond to positions on a food chain. thus producers always belong to the first tr
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd