Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
What are antioxidants?
To put it simply, antioxidants are important naturally occurring nutrients, (vitamins, minerals) which help to protect body from certain types of cancers. Vitamin A, vitamin C and vitamin E are well proved antioxidants in treating cancers such as gastrointestinal, cervical and breast cancers. Also, antioxidants decrease the risk of cancer mortality.
How Water content Influence the RS content? The yield of RS formed in heat-moisture treatment is closely related to water content, which may be an inherent component of food or
Meteorological Factors and Air Pollution Air pollution levels in a region are affected by wind, location, topography, precipitation and temperature inversions. Wind can carry
DEALCOHOLISM - Treatment of alcoholism or withdrawal symptoms of alcohol is known as dealcoholism. Recovery from alcohol dependence is greatly aided by sociobehavioural c
Properties of pyridoxine a) It forms white, odourless crystals. b) The compound is readily soluble in water. c) When a neutral or alkaline solution of pyridoxine is
Carbomedics Valve : Almost similar to StJude Medical valve, his is a low profile bileaflet valve made of pyrolitic carbon. On echo cardiography four small jets of regurg
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Name the Associated Foods used in bacillus cereus Cereal dishes that contain corn and corn starch, mashed potatoes, vegetables, minced meat, liver sausage, milk, cooked meat.
get introduction
Explain Resistance to Infection in Nutritional Care? Amino acids help to build the body's defence mechanisms like antibodies, blood cells, hormones and enzymes so as to prevent
Question 1. State the basic properties of light. Discuss the special features of ultra-microscopy and phase contrast microscopy 2. What are ultrasonic waves? Explain the dif
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd