Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Value of biodiversity?
Today, there is widespread concern for conservation of wild animals and plants. One might wonder why there is so much concern about protecting other species when our own species is facing poverty and starvation? The truth is, poverty and starvation, and several other ills facing humans are often the result of the destruction of biodiversity. Though we seldom realise it, biological diversity and its components are the very basis of human survival providing food, energy, medicine, ecosystem sources, scientific insights and cultural sustenance to over six billion people.
Understanding the value of biological diversity is vital to maintain the enormous range of genes, species and ecosystems that the earth supports. This can be looked at in many ways. One way would be to understand the "resource" or "use" value of various components of biodiversity which are used by humans. Biodiversity has also, however, great "non-resource" or "non -use" value such as maintaining ecosystem functions. Biodiversity can also be viewed in terms of economic and non-economic values. The economic value of a biological resource may be broken down into a range of use and non-use values that are of direct or indirect benefit of humans.
What factors lead to spoilage of fish flesh? A difference in the composition of tissues among different species, climate, procurement and holding practices are amongst few of
Ask qimporatance of sponge in tourism industry
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Two homologous human chromosomes have the following structure: where the letters represent genetic markers and the black dot represents the centromere. 1. Diagram the two chromosom
Describe how the hypothalamus regulates the secretion of anterior pituitary hormones and identify all of the individual hypothalamic regulatory factors. Describe how the hypothalam
Preparation of Patient for Fasting Blood Sugar Analysis 1. Blood for fasting blood sugar (plasma glucose) analysis should be drawn after the individual has fasted overnight (8-
Subphylum Chelicerata. Six pairs of appendages, four pairs being legs, with paired chelicerae (fangs). There are three classes in this phylum.
PKU is a recessive disorder. Suppose two people who were heterozygous for PKU married and had a child. What is the probability that the child will have PKU?
What are the different patterns of cleavage (segmentation of fertilized egg cell)?
What compound composes most of the cell membrane? How is this compound suited to the function of the membrane? Phospholipid composes most of the cell membrane. The hydrophob
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd