Use values of biodiversity, Biology

Assignment Help:

Despite its importance, determining the value or worth of biodiversity is complex and often a cause for debate. This is largely due to the fact that the worth placed on biodiversity is a reflection of underlying human values, and these values vary dramatically both among societies and individuals. The perspective of rural versus urban dwellers towards wildlife is one example. People that don't live with elephants on a daily basis, appreciate elephants for their sheer size, charisma, and intelligence. However, those who live near elephants tend to perceive them as a threat to people, crops and property. Values are also dynamic; they change over time, and they depend on a specific situation. Both the diversity of values towards a species and the changes in values over time can be examined in the case of vultures in India. Once widespread throughout India, vultures are getting deplete d.


Related Discussions:- Use values of biodiversity

Autotomy and regeneration, Autotomy and Regeneration Shedding of body...

Autotomy and Regeneration Shedding of body parts in self-defense to avert the attention of the predator-enemy or in any other emergency is a type of autotomy (auto: self, tom

Steroid and thyroid hormones, Steroid and Thyroid Hormones Cytoplasmic...

Steroid and Thyroid Hormones Cytoplasmic receptors for steroids are proteins with two subunits that bind to the steroid molecules. When both receptor sites are occupied by the

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Chromosomal type-genetic basis of sex determination, Chromosomal Type-Genet...

Chromosomal Type-Genetic basis of Sex Determination It refers to the condition where the genes involvcd in sex dcterrnincltion arc located on specific chromosomes known as the se

Chiropterophily - cross-pollination, Chiropterophily - Cross-pollination ...

Chiropterophily - Cross-pollination Pollination brought about by bats is called cheiropterophily. Bats which feed at night and do not see very well, are frequent pollinators i

Hepatitis, He p atitis Hepatitis is defined as degenerative/ inflamma...

He p atitis Hepatitis is defined as degenerative/ inflammatory processes of the liver. The clinical manifestations associated with hepatic dysfunctions results from impairmen

Main constituents of the earth''s atmosphere in our time, What are the main...

What are the main constituents of the earth's atmosphere in our time? The present atmosphere of the earth is constituted essentially of molecular nitrogen (N2) and molecular ox

How cycling is beneficial for proper health, How Cycling is beneficial for ...

How Cycling is beneficial for proper health Cycling is best for maintenance of fitness. It is a popular exercise and can be done by individual of all ages. Bicycle is required

Breakfast consists of a cup of black coffee, Your breakfast consists of a c...

Your breakfast consists of a cup of black coffee with sugar as well as a plain bagel covered with cream cheese. Describe the digestion of this breakfast as it passes through each m

Explain phylum cnidaria - coelenterates, Explain Phylum Cnidaria - Coelente...

Explain Phylum Cnidaria - Coelenterates? Members of the Phylum Cnidaria and one other group-Phylum Ctenophora (the comb jellies)-are the only two animal phyla that have radiall

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd