Use values of biodiversity, Biology

Assignment Help:

Despite its importance, determining the value or worth of biodiversity is complex and often a cause for debate. This is largely due to the fact that the worth placed on biodiversity is a reflection of underlying human values, and these values vary dramatically both among societies and individuals. The perspective of rural versus urban dwellers towards wildlife is one example. People that don't live with elephants on a daily basis, appreciate elephants for their sheer size, charisma, and intelligence. However, those who live near elephants tend to perceive them as a threat to people, crops and property. Values are also dynamic; they change over time, and they depend on a specific situation. Both the diversity of values towards a species and the changes in values over time can be examined in the case of vultures in India. Once widespread throughout India, vultures are getting deplete d.


Related Discussions:- Use values of biodiversity

Determine the final cell volume, Find the initial osmotic pressure at room ...

Find the initial osmotic pressure at room temperature for a cell if the only ions present are KCl and NaCl on either side of the membrane. Assume the concentrations for K+ and Na+

Unitary explanation for protein synthesis, Q. Why is the concept of a singl...

Q. Why is the concept of a single gene as ultimateunit of inheritance inadequate to provide a unitary explanation for protein synthesis, recombination and mutation? Answer:

Nutrition, examples of heterotrophic nutrition

examples of heterotrophic nutrition

Define recommended dietary allowances for vitamin d, Define Recommended Die...

Define Recommended Dietary Allowances for Vitamin D? The recommendations of vitamin D are expressed as IU. 1 IU is defined as the activity contained in 0.025 mcg of cholecalci

Express the genotype and phenotype of the male, 1. In rabbits, black fur is...

1. In rabbits, black fur is dominant to brown, and long hair is dominant to short hair. A male is mated to several brown, short-haired females. These matings result in the followin

Define guidelines of school children and adolescents, Define Guidelines of ...

Define Guidelines of School Children and Adolescents? 1) Do not skip breakfast. At least have milk, fruit and cereal. Some children prefer to flavour the milk with cereal or pr

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Will argon tend to form bonds with other elements, The atomic number of arg...

The atomic number of argon is 18. Will argon tend to form bonds with other elements? Describe your answer. Argon will not tend to form bonds with other elements. With an atomi

Which hormones secreted by adrenal medulla, Q. What are the hormones secret...

Q. What are the hormones secreted by the adrenal medulla? What are their respective functions? The medullary portion of the adrenals secretes hormones of the catecholamine grou

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd