types of ovule, Biology

Assignment Help:
long ans about types of ovules

Related Discussions:- types of ovule

What are the main harms caused by vitamin a deficiency, What are the main h...

What are the main harms caused by vitamin A deficiency? How does this vitamin act in the physiology of vision? Deficiency of vitamin A (retinol) might be cause night blindness

Define the future challenges of spatial processes, Define the Future challe...

Define the Future challenges of spatial processes? Understanding the dynamics of stochastic spatial systems, systems with a multitude of spatial scales, and systems along with

Which protein component include organic matter of skin, This main protein c...

This main protein component of connective tissue in mammals includes most of the organic matter of skin, bones, tendons, and teeth and occurs as fibrous inclusions in most other bo

Explain the naturally occurring food chemicals, Explain the Naturally occur...

Explain the Naturally occurring Food Chemicals? Pharmacologically active substances include vasoactive amines such as histamine, tyramine, tryptamine, phenylethylamine, and ser

Do we know what causes mental illnesses or how to treat them, Do we know wh...

Do we know what causes mental illnesses, or how best to treat them? Mental illnesses take various forms: debilitating sadness in depression; uncontrollable repetitive actions i

What is intermittent st depression, What is Intermittent ST Depression ? ...

What is Intermittent ST Depression ? Ans. Several patients progress from variable ST-segment depression, often associated with respiration, to the classic ST-segment chang

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain procedure for simple staining of bacterial cultures, Explain Proced...

Explain Procedure for Simple Staining of Bacterial Cultures? Now carry out the exercise following the steps given herewith: (1) Prepare thin bacterial smear on clean glass s

Use of aldehydes as chemical sterilant, Q. Use of Aldehydes as chemical ste...

Q. Use of Aldehydes as chemical sterilant? Formaldehyde: widely employed for the fumigation of operation theatres. Glutaraldehyde: commercial preparations are active at

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd