Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Types of Leukemia
Leukaemia may be chronic or acute and is classified into the following categories:
i) Acute Lymphocytic Leukaemia (ALL)
This is the most common form of children leukaemia and accounts for about 80 per cent of childhood leukaemias. In this type of disease lymphoid cell line is affected. The ALL can be sub-classified on the basis of cellular characteristics related to thymic (T cell) and bursal-equivalent (B cell) origin of normal lymphocytes.
ii) Acute Non-lymphocpic Leukaemia (ANLL)
This is a group of malignant disease in which the basic abnormality is a generalised progressive proliferation of mature monocytes and myelocytes fiom the bone marrow that invade the blood and other tissue. These include acute myeloblastic or myelocytic Leukemia (AML), acute promyelocytic leukemia (APML), acute monocytic leukemia Hamafologiul Disorders (AMML) and acute monocytic leukemia.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Role of citrate Citrate in addition to being an intermediate of citric acid cycle provides a source of acetyl CoA for the cytosolic synthesis of fatty acids. Citrate inhi
Q. Do plants have tissue organization and specialized organs? Plants have specialized organs (like roots, limbs, reproductive organs, leaves) and differentiated tissues (suppor
Q. Definition of Consciousness? Consciousness is a phenomenon that is shared by nearly all people. It cannot be directly seen or touched. Yet it is real enough to most people.
Explain acylglycerols The most abundant class of food lipids is the acylglycerols, also known as glycerol esters of fatty acids, which dominate the composition of depot fats in
Define Drug Effects on Food Intake - gastro intestinal tract? Affect the gastro intestinal tract: Gastrointestinal irritation and ulceration are serious problems with many drug
Congenital Defects Related to Kidney/Upper Urinary Tract i) Renal Agenesis A new born baby with this condition may show low set ears, flat nose, prominent epicanthic
What are the factors responsible for corneal hydration? The factors responsible for corneal hydration are as follows: i. Stromal swelling pressure ii. Barrier function of
Explain Mechanism for reduce the absorption of nutrients? The absorption of nutrients is also reduced by mechanisms other than increasing the viscosity of gastrointestinal cont
Influence of LV Function : LV functions, whether normal or impaired is important while selecting a patient for CABG and for long-term results of surgical revascularisation. If le
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd