Internet meanings for: URL HTTP COOKIES, Biology

Assignment Help:
Internet meanings for:
URL HTTP COOKIES
BAUD WWW COMP
What Is The Internet?
What do you need to connect to the Internet?
Advantages and disadvantages of the Net
URL
A URL is a Uniform Resource Locator. Think of it as a networked extension of the standard filename concept: not only can you point to a file in a directory, but that file and that directory can exist on any machine on the network, can be served via any of several different methods, and might not even be something as simple as a file: URLs can also point to queries, documents stored deep within databases, the results of a finger or archie command, or whatever. Here is an example of a URL it’s the address of the web site where I found out about URL''s: https://www.ncsa.uiuc.edu/demoweb/url-primer.html

HTTP
Hyper Text Transfer Protocol

COOKIES
A small set of files used to help when you go on the Internet (they are like a footprint that you leave behind, and next time you go to that site, they know you are visiting again)

BAUD RATE
Is the speed of the modem, Bytes per second (that’s the amount of information that can be transferred from one computer to another in a selected amount of time) Our modem is a 56K modem, that means it can transfer 56000 characters per second.

WWW
World wide web.

COMP
Shortened word for computer.

The whole of the Internet is made up of lots of different categories and sections such as:
Games
Chat rooms
Shopping
Jokes
Information
And lots more that I have not mentioned.The Internet is a world wide collection of information which is stored on lots of different computers in many different buildings.
The World Wide Web goes on so people can find out about different things without having to leave their own homes.
The INTERNET began because the United States Military wanted a way of protecting their computer information and it was important that if a computer site was destroyed by the enemy, then other computers would still work. In the 1970''s and 1980''s the Internet was mainly used by Military and University people, however, from the 1990''s it became accessible by many people at home and at work.
Today, many people use the Internet to send mail, to research information, to do banking, to do shopping, and to chat with friends.When you go surfing on the net, you will find pages which are made up of lots of links, the links will take you to more information about this topic, or might take you to a totally different site.An example of a hyperlink are the buttons to go home on this page, click on the HOME button and you will jump to the top of the document.

What do you need to connect to the Internet?

• Computer
• Modem
• Telephone Line
• Internet Software
• Time with an Internet Service Provider (ISP)

When you join an ISP, (e.g. Dingo Blue, Bigpond etc) you are given a username and password and a telephone number to dial on your computer. When you log onto your ISP, you can then search the internet - surfing - you will use a search engine like yahoo. You can also send and receive mail, I use Hotmail, this lets me check my emails from any computer that is logged onto the internet. I can talk to my friends using MSN Messager. I have also used MICQ to chat with lots of people throughout the world.
Sometimes, you might want to shop for presents on the Internet, for instance, you can search using YAHOO for what you want and lots of sites will be displayed, you can then go into the site, and add the items that you want to buy into your shopping cart. You usually need a credit card to shop over the internet. You can also win prizes over the internet. For example, I was able to collect tokens by buying boxes of Arnotts biscuits, then when I had enough tokens, I was able to post them to the competition and they posted me a password to log onto the prize site, I then selected the CD I wanted and typed in my password, a couple of weeks later, my CD arrived in the mail. You can also find really cool screen savers and pictures on the net. You can download music from sites like NAPSTER, you just type in the song that you want and you download it, it takes a little while to download the song, but then you can play them whenever you want.

Advantages and Disadvantages of the INTERNET
Advantages Disadvantages
More ways to communicate You can get bugs (viruses) on your computer
You don''t have to leave your house to shop More local businesses may have to close down because people are buying their products over the net
Napster - you don''t have to buy CD''s to listen to your favourite music NAPSTER - sometimes they don''t have all the songs you want. Music companies are losing money, there was a court case recently over copyright of songs.
You can talk with people all over the world using chat sessions Chatting - you don''t know who you are talking to and if they are telling the truth or not


Related Discussions:- Internet meanings for: URL HTTP COOKIES

Foods for growth in microorganisms, Q. Foods for Growth in microorganisms? ...

Q. Foods for Growth in microorganisms? Microorganisms differ in their ability to use various nitrogenous compounds as a source of nitrogen for growth. The primary nitrogen sour

Which is the other adnexal gland of the digestive system, Besides the liver...

Besides the liver which is the other adnexal gland of the digestive system that releases substances in the duodenum participating in extracellular digestion? The other adnexal

Atrial fibrillation or flutter, Q. Atrial Fibrillation or Flutter? Tran...

Q. Atrial Fibrillation or Flutter? Transient atrial fibrillation or flutter is seen frequently and can be associated with CAD, rheumatic heart disease, thyrotoxicosis, or myoc

What is the imporatnce of food preservation, Imporatnce of food preservatio...

Imporatnce of food preservation These include: increased shelf-life decreased hazards from microbial pathogen decreased spoilage (microbial, enzymatic) in

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Phosphorylation of fructose-6-phosphate, Phosphorylation  of  fructose-6-...

Phosphorylation  of  fructose-6-phosphate Phosphorylation  of  fructose-6-phosphate: This  is  an irreversible reaction, catalyzed byphosphofructo72Snase,  (PFK-  I) a rate-l

Dietary management during myocardial infarction, Dietary management during ...

Dietary management during Myocardial Infarction? Patients who suffer from an attack of myocardial infarction are hospitalized and are usually kept under strict medical supervis

Explain the eligibility of cardiac rehabilitation, Explain the eligibility ...

Explain the eligibility of Cardiac rehabilitation ? Cardiac rehabilitation services are prescribed for patients who: 1) Have had a myocardial infarction. 2) Have had coronary b

What is an example of a parasite relationship, What is an example of a para...

What is an example of a parasite relationship? An example would be a flea and a dog. The flea drinks the dog's blood, but does nothing helpful for the dog.

Discuss in detail about the close head injuries, Discuss in detail about th...

Discuss in detail about the Close Head Injuries Closed-head injuries result from a blow to the head, which can subject the brain to a variety of mechanical forces: Damag

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd