The smooth er and rough er are similar functions, Biology

Assignment Help:

What functions of the smooth ER and rough ER are similar?


Related Discussions:- The smooth er and rough er are similar functions

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What food items include in full liquid diet, What food items  include in f...

What food items  include in full liquid diet -  Soups and broths -  Cereal porridges (refined cereals) -  Milk and milk beverages, yoghurt - Coffee, tea, fruit  juices

Artificial inspiration, Artificial Inspiration : a. After artificial exp...

Artificial Inspiration : a. After artificial expiration, the rescue worker should slowly release the pressure on the back of the victim. b. This will cause the chest cavity t

Target tissues and target organs of the neurohypophysis, Q. Which are the t...

Q. Which are the target tissues and target organs of the neurohypophysis? The target organs of oxytocin are the mammary glands and the uterus and target organs of ADH are the k

Explain the storage of vitamin e, Explain the Storage of Vitamin E? Vi...

Explain the Storage of Vitamin E? Vitamin E is mainly stored in muscles and adipose tissue. Vitamin E content of erythrocytes is about 20 percent of that in plasma and there i

Normality, what is the normality law?

what is the normality law?

Clinical features - rheumatic fever, The American Heart Association (AHA) h...

The American Heart Association (AHA) has recommended the revised Jones Criteria as a guide for ARF diagnosis. The same have been approved by WHO study group for the diagnosis of in

How is lymph propelled through the lymphatics, How is lymph propelled throu...

How is lymph propelled through the lymphatics? Some of the larger lymphatics are capable to contract, or else the lymph is propelled by body muscles which contract and 'squash'

Procedures related to hygenic care, PROCEDURES RELATED TO HYGENIC CARE ...

PROCEDURES RELATED TO HYGENIC CARE Would you like to remain without a bath on any given day? Do you remain without a bath when you are sick.? No one normally, would like to m

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd