Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Syngamy - Patterns of Sexual Reproduction
Sperm fuses with the egg. This results in both the union of the paternal nucleus with the maternal one (karyogamy), as well as the fusion of the cytoplasms of the two gametes (plasmogamy). Syngamy leads to fertilisation producing a zygote which develops into new individuals, depending upon the size and shape of the gametes involved, syngamy can be subdivided into three types.
i) Isogamy: The gametes are morphologically similar although they may differ in their physiological and biochemical properties. For example, the gametes produced from the male and female gametocytes of Monocystis.
ii) Anisogamy: The gametes differ in size and structure and are collectively known as anisogametes. Of these, the smaller ones are usually more numerous and motile. They are called the male gametes (or the micro-gametes as in protozoans and the sperms as in metazoans). The fusion of micro - and macro-gametes is known as anisogamy. It is frequently found in protozoans as in Plasmodium and Vorticella. In higher phyla the term fertilisation is used instead of anisogamy.
iii) Oogamy: In oogamy one gametes type is always motile and usually small (the sperm) and the other is always nonmotile and large (the egg). All metazoans exhibit oogamy. The eggs of most fully terrestrial non-chordates such as insects have shelled eggs. The shell bears a minute pore (micropyle) for allowing the entry of sperms for fertilization.
What do you mean by Post-Herbal Period ? Ans. It is difficult to draw a sharp line of demarcation between the transition period, marked by various attempts of classificati
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Question 1 Describe any two possible mechanisms of mutagenesis 2 Explain any five functions of Endoplasmic reticulum 3 Write short note on Ames test 4 Describe the structure an
Diploidy and Haploidy :: In the chromosomal complement given species not all the chromosomes are different from each other .In fact these are in pairs ,i.e. every two chrom
Give a detailed description of stereoblastula, please ?#
Differential reinforcement (Training of incompatible behaviour)- Differential reinforcement of incompatible behaviour (DRI) is used to decrease a frequent behaviour without pun
P o x diseases Small-pox in human beings and pox in a few animal species are closely related to each other. It is shown by the fact that the vaccine for the prevention of sma
Q. What are the final energetic products of every round of the Krebs cycle? And Where is most part of the utile energy at the end of Krebs cycle found? After each round of the
Difference between beta and gama taxonomy
Describe Basic steps in genetic engineering
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd