Somatoform disorders, Biology

Assignment Help:

SOMATOFORM DISORDERS:

The term 'Neurosis'  was first introduced in 1769 by William Cullen (1710-  1790). Till later part of nineteenth century, anxiety disorders were conspicuously missing from the  classification of psychiatric disorder. Mayer (1  886-1950) included in his nomenclature a separate description of neurosis, psychoses, affective states, organic braindisease  and sub normality.  

Sigmud Freud (1841- 1925) developed a classification of neuroses; and his concepts of neuroses have formed the foundation of psychoanalytical thought. 

Neurosis may be defined as a mild to moderately severe illness in the personality in which the ego  function of reality-testing  is greatly impaired, and in which the maladjustment  to life is relatively limited. (Bimla Kapoor 2001) In this unit you will read about different types of somatoform disorder, post traumatic disorder and psychophysiological disorder in specific to the classificatidn under ICD-  10.  


Related Discussions:- Somatoform disorders

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe about the lysosomes enzymes, Describe about the Lysosomes enzymes ...

Describe about the Lysosomes enzymes Within the cytoplasm of the cell, several hydrolytic enzymes (lytic enzymes) capable of hydrolysing proteins, nucleic acids and carbohydra

Write the meaning of diabetes mellitus, Q. Write the meaning of diabetes me...

Q. Write the meaning of diabetes mellitus? The word "diabetes" is from the Greek word meaning "a siphon". Diabetes patients had polyuria (passing excessive urine) and "pass it

What is biodiversity, What is biodiversity? Biological diversity is the...

What is biodiversity? Biological diversity is the several of species of living beings of an ecosystem. In ecosystems which are more bio diverse, as tropical forests, a great va

Why are vaccines used in the prevention of infections, Why are vaccines use...

Why are vaccines used in the prevention but not in the treatment of infections? Why can antivenom serums be used in prevention and treatment? Vaccines are not used in the treat

Who was charles darwin, Who was Charles Darwin? Charles Darwin was an Eng...

Who was Charles Darwin? Charles Darwin was an English naturalist born in 1809 and considered the father of the theory of evolution. At the end of the year 1831, before turning 23

Point out some difference between tumor and cancer, Point out some Differen...

Point out some Difference between Tumor And Cancer? Tumor is a swelling or growth because of an abnormal growth of tissue. Tumors can either be benign or malignant. The benign

Codex code of practice, Codex code of practice Codex Alimentarious Comm...

Codex code of practice Codex Alimentarious Commission (CAD) was established in 1963 with the objective to develop International Food Safety Standards to protect human health, w

Quantification tricuspid regurgitation-echo quantification, Quantification ...

Quantification of Tricuspid Regurgitation Echocardiography and right ventricular angiogram can quantify tricuspid regurgitation. Echo Quantification Trivial: Non susta

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd