Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
SOMATOFORM DISORDERS:
The term 'Neurosis' was first introduced in 1769 by William Cullen (1710- 1790). Till later part of nineteenth century, anxiety disorders were conspicuously missing from the classification of psychiatric disorder. Mayer (1 886-1950) included in his nomenclature a separate description of neurosis, psychoses, affective states, organic braindisease and sub normality.
Sigmud Freud (1841- 1925) developed a classification of neuroses; and his concepts of neuroses have formed the foundation of psychoanalytical thought.
Neurosis may be defined as a mild to moderately severe illness in the personality in which the ego function of reality-testing is greatly impaired, and in which the maladjustment to life is relatively limited. (Bimla Kapoor 2001) In this unit you will read about different types of somatoform disorder, post traumatic disorder and psychophysiological disorder in specific to the classificatidn under ICD- 10.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Describe about the Lysosomes enzymes Within the cytoplasm of the cell, several hydrolytic enzymes (lytic enzymes) capable of hydrolysing proteins, nucleic acids and carbohydra
in the oneward form
Q. Write the meaning of diabetes mellitus? The word "diabetes" is from the Greek word meaning "a siphon". Diabetes patients had polyuria (passing excessive urine) and "pass it
What is biodiversity? Biological diversity is the several of species of living beings of an ecosystem. In ecosystems which are more bio diverse, as tropical forests, a great va
Why are vaccines used in the prevention but not in the treatment of infections? Why can antivenom serums be used in prevention and treatment? Vaccines are not used in the treat
Who was Charles Darwin? Charles Darwin was an English naturalist born in 1809 and considered the father of the theory of evolution. At the end of the year 1831, before turning 23
Point out some Difference between Tumor And Cancer? Tumor is a swelling or growth because of an abnormal growth of tissue. Tumors can either be benign or malignant. The benign
Codex code of practice Codex Alimentarious Commission (CAD) was established in 1963 with the objective to develop International Food Safety Standards to protect human health, w
Quantification of Tricuspid Regurgitation Echocardiography and right ventricular angiogram can quantify tricuspid regurgitation. Echo Quantification Trivial: Non susta
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd