Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Solar Energy Input
We know that the spectral distribution and the intensity of solar radiation incident on the earth's surface are known. Of the enormous'amount of energy that is radiated by the sun (5.6 x l07 cal/min), only about one-half of 1 billionth of that amount is intercepted by the eafth. Not all the solar.radiation can penetrate the earth's atmosphere; however, the amount of solar energy received at the top of atmosphere is constant. This energy is reffered to as solar constant. It is defined as the rate at which solar radiation falls on a unit area is a plane surface, which is oriented peqiendicular to the solar beam, when the earth is at its mean distance from the sun. On an average the value of solar constant is 2 cal/cm2/min.
As the solar radiation &vels through the atmosphere it interkts wiith it and gets diminished in three different ways: by reflection, scamring and absorption. About 30% of the total incoming solar radiation is reflected by clouds and a portion of it is back-scattered and lost in space. About 19% of it is directly absprbed by oxygen, ozone, water, ice crystals and suspended particles.'This absorbed radiation is converted into heat energy and the air is warmed to some extent. The remaining 51 % is absorbed or reflected by earth's surface that is converted to heat. Thus a total of 70% (19% by atmosphere aid 51% by earth) of the radiation absorbed by em and atmosphere is involved in the functioning of our biosphere.The earth has a variety of surfaces - rough, smooth, ice-covered, or water-covered and areas with differeht types of vegetation. The amount of radiation absorbed or reflected depends upon the nature of surface. features i.e. topography of the area. The percentage of reflectivity of the incident radiation in meteorology is called albedo, which is Reflected radiation
Albedo = (reflected radiation)/(Incident radiation) x l00Albedo of snow covered landscapes is higher than vegetated landscape or water column. Freshly fallen.sn6w typically has an albedo between 75 to 95%. Ocean waters have low albedo and therefore they appear darker thw the adjacent continental land masses. Rough surfaces have low albedo than smooth surfaces. Also the light coloured surfaces reflect more thandark surfaces. Reflectivity also depends upon the angle of incident radiation. The surfaces that are less perpendicular to sun's rays are more reflective than surfaces that make almost a right angle with the incoming solar radiation. We have learnt that earth and atmosphere receive solar radiation, absorb a part of it and get warmed up. We also know that during night earth cools down. So where does the energy of radiation absorbed by the earth go? Actually, the absorbed radiation in turn is continually reradiatedfrom the earth as heat in the form of infrared radiation and is sent off to outer space continually. If it had not re-radiated the air temperature would rise steadily day by day.
Defone Economic consequences of malnutrition? Figure explains the economic consequences of malnutrition. You would note from the Figure that the economic productivity of the in
Was there molecular oxygen in the earth's primitive atmosphere? How has that molecule become abundant? The presence of the molecular oxygen in the primitive atmosphere was prob
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
RESPIR A TIO N IN SCORPION OR SPIDER - Respiratory organs are book lungs. A book lung is a chamber containing a series of thin, vascular, parallel lamellae arranged li
Determine the Functions of Organ during pregnancy? Dramatic changes occur in renal functions to eliminate the nitrogenous and other waste products of maternal and foetal metabo
Plants of the open water zone In this zone plants are restricted to the limnetic one and generally consist of phytoplankton such as dinoflagellates, blue green algae and green
Normal 0 false false false EN-IN X-NONE X-NONE
What is biological control? Biological control is a natural process to control the size of animal, microorganism or plant populations. Biological control is based on the knowle
What is predatism? Predatism is the ecological interaction in which one individual mutilates or kills another to get food. Predatism is an inharmonious (negative) ecological i
Theca - body form Protozoans It is a close-fitting hard structure around the plasma membrane, mainly composed of cellulose. It can be compared with the ceil wall of a plant ce
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd