Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What factors are altered when cells are moved, Which factors are altered wh...

Which factors are altered when cells are moved from an in vivo to an in vitro environment, and how do cells respond to these changes?

St. jude medical valve--types of valves, St. Jude Medical Valve (SJM) :  ...

St. Jude Medical Valve (SJM) :  This is a low profile bi-leaflet valve, which was introduced in 1977. The leaflets and the housing are made of pyrolitic carbon. The currently

Describe the metabolism of lipids, Q. Describe the metabolism of lipids? ...

Q. Describe the metabolism of lipids? Fats are split into fatty acids and glycerol by the enzyme. They are absorbed in small intestine and recombined into fats. It is stored in

What are similarities between proteins, What are some similarities between ...

What are some similarities between proteins, carbohydrates, and nucleic acids?

Protoplasmic streaming and tubular peristaltic flow model, Protoplasmic Str...

Protoplasmic Streaming and Tubular Peristaltic Flow Model The first of the above two models involves the well known phenomenon of cytoplasmic streaming in giant algal cells. C

Lead strength, When the R-wave in the lateral precordial leads is less than...

When the R-wave in the lateral precordial leads is less than 10 mm the sensitivity of ST depression is very low if 1 mm of ST depression is used as a standard. The corrected ST for

Develop questions which will facilitate effective research, Theories are im...

Theories are import because they can be used to a. Test research hypothesis b. Develop questions which will facilitate more effective research c. Conduct more meaningful and useful

Define ultrasonic and sonic vibrations, Ultrasonic and sonic vibrations ...

Ultrasonic and sonic vibrations Cells of all types can be destructed by intense sonic and ultrasonic vibrations generated by magnetostrictive oscillations or peizo electric cry

Antibody structure, Antibody Structure: An antibody molecule consist of...

Antibody Structure: An antibody molecule consist of two alike light chains ( 220  amino acids each) ad two similar heavy chains (about  440-450  amino acids each) held together

What are the major organic molecules for living beings, Q. What are the maj...

Q. What are the major significant organic molecules for living beings? There are many types of organic molecules that are important for the living beings. Particularly importan

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd