Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Mineral nutrition, Normal 0 false false false EN-IN X...

Normal 0 false false false EN-IN X-NONE X-NONE

What are the signs used in acute pericarditis, Q. What are the Signs used i...

Q. What are the Signs used in acute pericarditis? • Pericardial friction rub is pathognomonic of pericarditis. It is heard as a phasic scatching sound. It may vary with phases

How can you convert 147.05mg%, How do you convert 147.05mg% of plasma gluco...

How do you convert 147.05mg% of plasma glucose to mM/L please show work.

Gastrointestinal hormones, Gastrointestinal Hormones The three main ma...

Gastrointestinal Hormones The three main mammalian gastrointestinal hormones are secretin, gastrin and cholecystokinin (CCK). There are several other hormones all peptides. Th

What type of athlete, What type of athlete would have a above average react...

What type of athlete would have a above average reaction time please explain.

Recycling of plasma membrane components, Recycling of Plasma Membrane Compo...

Recycling of Plasma Membrane Components During exocytosis secretory vesicles fuse with plasma membrane, adding to the membrane surface area. Yet, the surface area of plasma me

Define equilibrium conditions in multicomponent systems, Define Equilibrium...

Define Equilibrium Conditions in Multicomponent Systems? This chapter applies equilibrium theory to a variety of chemical systems of more than one component. Two different appr

Photosynthesis, test to prove that carbondioxide is needed for photosynthes...

test to prove that carbondioxide is needed for photosynthesis to take place

What is frog central nervous system, What is frog central nervous system ...

What is frog central nervous system Consider Neuron B in the frog central nervous system whose plasma membrane has a newly discovered ligand-gated ionotropic receptor, named th

Methods of estimation of energy expenditure and requirements, Define Method...

Define Methods of Estimation of Energy Expenditure and Requirements? There are a variety of methods available to measure human energy expenditure. Knowledge of these methods wi

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd