Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Taeniasis Taeniasis is a zoonotic disease caused by specific cestodes. The two parasites of major importance are Taenia saginata and T. solium. Both in their adult forms, are
1. You have two bags of polymer. Bag A has 10 kgs of polymer with weight average molecular weight of 336.6 kg and Bag B has 20kg of polymer with weight average molecular weight 39
Explain cardiac examination auscultation and its techniques? Auscultation of the heart sound and associatcd sound is very important to diagnose the cardiovascular diseases. It
Q. Scheme of Classification of phylum hemichordate? These are about 90 species of hemichordates. All are marine and live in the open sea or in muddy sediments. Hemichordata wer
Inorganic Substances - Abiotic Components There are about forty elements that are required in various processes of living organisms. Some of these are macronutrients which the
What is genetic engineering? The Genetic engineering is the use of genetic knowledge to artificially manipulate genes: It is one of the fields of biotechnology.
Q. Illustrate Wild Life Sanctuaries? You must have seen how some of the parks are fenced. The intention is to keep the animals from wandering out and not to destroy neighbourin
Why isn't the cooking of vitamin C-containing foods appropriate for vitamin C supply? To obtain vitamin C, for example, from an orange dessert, the vitamin-containing food cann
An organism has 16 chromosomes in its somatic cells. Determine the number of gametes with different chromosome compositions that it can potentially create. Explain your answer. Ign
Describe Implant exposure ? Sound surgical principles to minimize the surgical exposure based on the access required should be employed. A series of surgical approaches to achie
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd