Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Female reproductive system - fallopian tube, F ALLOPIAN TUBE - Ferti...

F ALLOPIAN TUBE - Fertilisation occur in it. 10-12 cm long muscular tube. It is supported by double fold of peritonium. It shows 4 regions - (i ) Infundibulum - Bro

How computed tomography helps the doctors, Explain briefly how computed tom...

Explain briefly how computed tomography (CT) helps the doctors in pinpointing the defects in the patient's body

Apex locator in retreatment cases-endodontics principles, Apex locator in r...

Apex locator in retreatment cases: -    Electronic apex locators may give misread for working length when gutta-percha is initially being removed. -    Due to that file beging

Sketch arctic antifreeze protein and dna, When I had predicted into class, ...

When I had predicted into class, we had a huge snow storm this weekend. Now what I want you to do are to engineer several grass for my yard therefore my grass never lets snow accum

What are the two reactants, What are the two reactants and the two products...

What are the two reactants and the two products of a dehydration reaction/ what are the two reactants and products of a hydrolysis reaction.

Cancer, What is Cancer? Besides AIDS, Cancer is another deadly human di...

What is Cancer? Besides AIDS, Cancer is another deadly human disease of our times about which people are panicky all over the world. It is estimated that one in every three per

What is retrograde peri-implantitis, Retrograde Peri-Implantitis It has...

Retrograde Peri-Implantitis It has been described by Misch as implant failure probably due to bone microfractures caused by premature implant loading or overloading, other form

Probability concept of requirements vs risk of deficient, Define Probabilit...

Define Probability concept of requirements vs risk of deficient and excess intake? Figure best illustrates the concept of a requirement for an essential nutrient. The relations

Leucosolenia, special character of leucosolenia

special character of leucosolenia

Spermatogenesis, Spermatogenesis In multicellular organisms the repro...

Spermatogenesis In multicellular organisms the reproductive process commences with the production of gametes. The gametes are the sex cells that develop inside the gonads, th

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd