Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Biodiversity maintains, Biodiversity maintains the air we breathe and the w...

Biodiversity maintains the air we breathe and the water we drink. Green plants purify our air and our water by taking in carbon dioxide, regulating water vapour, releasing oxygen,

Explain the mitotic prophase, Which of the following best explains what wou...

Which of the following best explains what would happen if recombination (crossing-over) happens during mitotic prophase? A. Recombination during mitosis will lead to segregatio

Expression of variability, In the previous sub-section we discussed the pos...

In the previous sub-section we discussed the possible ways by which variabiliti can, be generated. We shall now examine one instance that illustrates the consequence of variability

Define microorganism in fermentation foods process, Normal 0 fa...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Terms of incubation time and the generation time, If the generation time (t...

If the generation time (t) is the incubation time (t) per generation (G), or t = t/G, rewrite the formula you derived in question 2 for bacterial population growth in terms of incu

What is an instance of a hypothesis, Q. What is an instance of a hypothesis...

Q. What is an instance of a hypothesis which may explicate why there is not a big representation of the class Reptilia found in Polar Regions? Beings of the class Reptilia are

Introduction to meat products, Meat products Meat is an important commo...

Meat products Meat is an important commodity in the diet of people in view of its complimentary role in balancing the diet with rich source of amino acids, vitamins and mineral

Egestion, After the food intake is over, the food gets digested, assimilate...

After the food intake is over, the food gets digested, assimilated and finally egested through the kidneys and anus. The urinary system: • Filters waste materials from the blood

What is metachronal wave. describe., What is Metachronal wave? Describe. ...

What is Metachronal wave? Describe. During the coordination of the ciliary movement, bands, or groups of cilia, are at different stages of their beating pattern, and this creat

Water adaptations, Water Adaptations After becoming familiar with the t...

Water Adaptations After becoming familiar with the two kinds of water stresses you would like to know about the adaptations in plants and animals which enable them to survive u

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd