Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Define the effects of deficiency of calcium in the body, Define the effects...

Define the effects of Deficiency of Calcium in the Body? If there is a continued inadequate intake or poor intestinal absorption of calcium, plasma calcium concentrations will

How mineral salts participate in enzymatic activity, Q. How mineral salts p...

Q. How mineral salts participate in enzymatic activity? Many mineral salts are cofactors of enzymes that are the substances without which enzymes do not work.

What is the difference between dna and rna, Concerning their biological fun...

Concerning their biological function what is the difference between DNA and RNA? DNA is the source of information for RNA production (transcription) and therefore for protein s

Explain principle of fehling''s soxhlet method, Explain Principle of Fehlin...

Explain Principle of Fehling's Soxhlet method (Lane-Eynon method)? Reducing sugars are those which have free sugar groups and hence may be estimated directly by titrating the s

Define effect on human placental lactogen in pregnancy, Define effect on Hu...

Define effect on Human placental lactogen in pregnancy? Human placental lactogen, with a structure similar to the growth hormone, increases throughout pregnancy. Its rate of pr

What do you mean by proteinuria, Q. What is proteinuria? Why is proteinuria...

Q. What is proteinuria? Why is proteinuria a sign of glomerular renal injury? Proteinuria means losing of proteins through urine under normal conditions proteins are too big to

ALGAE., HOW ARE THE ORIGIN AND EVOLUTION OF ALGAE..

HOW ARE THE ORIGIN AND EVOLUTION OF ALGAE..

Explain the toxicity of nicotinic acid, Explain the Toxicity of nicotinic a...

Explain the Toxicity of nicotinic acid? Although therapeutically useful in lowering serum cholesterol, administration of chronic high oral doses of nicotinic acid can lead to h

Explain the determination of folic acid, Determination Reductive hydrol...

Determination Reductive hydrolysis of folic acid produces 4-aminobenzoyl glutamic acid which is determined photometrically after  diazotization and coupling with N-(1-naphthyl)

How is the circulatory system of reptiles characterized, Q. How is the circ...

Q. How is the circulatory system of reptiles characterized? What is the basic difference between the amphibian and the reptile heart? The circulatory system of beings of the cl

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd