Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What do you mean by fixation?, What do we mean by fixation? Fixation is...

What do we mean by fixation? Fixation is the process of preserving internal and external structures of microorganisms.  It leads to the killing of microbial cells and their fir

Explain acyclovir-resistant hsv, Resistance Acyclovir-resistant HSV oc...

Resistance Acyclovir-resistant HSV occurs mainly in immunocom- promised patients treated with the drug; isolates are usually also resistant to valacyclovir and famciclovir. Re

Explain about anterior superior alveolar nerve, Anterior superior alveolar ...

Anterior superior alveolar nerve It is a branch of infraorbital nerve which arises within the infraorbital canal. It gives a nasal branch which passes into nasal cavity to supp

Explain cytoskeleton, What is cytoskeleton? What are its main constituents ...

What is cytoskeleton? What are its main constituents in animal cells? Ans) Cytoskeleton is the cytoplasmic structure that handles the cell, keeps its shape and fixates and moves

Etiologic factor of congestive cardiac failure, Q. Etiologic factor of Cong...

Q. Etiologic factor of Congestive Cardiac Failure? Congestive heart failure develops over a period of time when the necrotic tissues are not replaced by functional connective c

Neo-zoonoses, Neo-zoonoses In recent times, some of the pre-existing l...

Neo-zoonoses In recent times, some of the pre-existing low profile and less frequent zoonoses and some entirely newly recognized zoonoses are emerging with a new dimension. Th

Scientific name of the etiological agent of chagas disease, Q. Which is the...

Q. Which is the kingdom of the parasites that cause malaria and Chagas' disease? Those maladies are caused by the protozoans, beings of the kingdom Protista. Q. What is the

What are the main sources of mercury pollution, What are the environmental ...

What are the environmental harms caused by mercury pollution? What are the main sources of mercury pollution? Mercury is a metal that when present in the water of lakes, river

Ammonia assimilation, Ammonia Assimilation - Inorganic Nitrogen and Sulphur...

Ammonia Assimilation - Inorganic Nitrogen and Sulphur Metabolism Nitrogen (N 2 ) gas and NO 3 are the most common available forms of inorganic nitrogen. Both are enzymaticall

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd