Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
F ALLOPIAN TUBE - Fertilisation occur in it. 10-12 cm long muscular tube. It is supported by double fold of peritonium. It shows 4 regions - (i ) Infundibulum - Bro
Explain briefly how computed tomography (CT) helps the doctors in pinpointing the defects in the patient's body
Apex locator in retreatment cases: - Electronic apex locators may give misread for working length when gutta-percha is initially being removed. - Due to that file beging
When I had predicted into class, we had a huge snow storm this weekend. Now what I want you to do are to engineer several grass for my yard therefore my grass never lets snow accum
What are the two reactants and the two products of a dehydration reaction/ what are the two reactants and products of a hydrolysis reaction.
What is Cancer? Besides AIDS, Cancer is another deadly human disease of our times about which people are panicky all over the world. It is estimated that one in every three per
Retrograde Peri-Implantitis It has been described by Misch as implant failure probably due to bone microfractures caused by premature implant loading or overloading, other form
Define Probability concept of requirements vs risk of deficient and excess intake? Figure best illustrates the concept of a requirement for an essential nutrient. The relations
special character of leucosolenia
Spermatogenesis In multicellular organisms the reproductive process commences with the production of gametes. The gametes are the sex cells that develop inside the gonads, th
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd