Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Criteria for Assessment of Vitamin K Status? The parameters of blood clotting time and prothrombin time are used as criteria to assess vitamin K status as this vitamin
different applications of microbiology
What are the symptoms and foods associated with campylobacteriosis? Campylobacteriosis incubation period: 2-5 days after ingestion of contaminated food. Symptoms: Diarrhoe
Dispersal of Seeds A plant usually bears many fruits and innumerable seeds. If all the seeds produced by a plant were to germinate in the immediate vicinity, this will have s
Factors affecting lipid oxidation Temperature In general, the rate of oxidation increases as the temperature is increased. Temperature also influences the relation betw
Sample Outline of Child History Questionnaire Basic identifying data: Child's name Date of birth Date of evaluation Person referring for evaluation Per
Social Determinants of Health - Transport Rising worldwide incomes have led to a massive use of automobiles and in particular cars. Cars are seen as a threat to health because
International organization and zoonoses In 1962, the Food and Agriculture Organization and the World Health Organization created the Codex Alimentarius Commission (Codex) to e
State two characteristics of humans which distinguish them from other primates. Two features which differentiate humans from other primates are their upright posture and their
a) Name two food additives needed to keep food wholesome, and say what they do. b) Name two food additives (or types of additive) which are not necessary for keeping fo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd