Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
The cardiovascular system controls the movement of blood through thousands of miles of capillaries so that every tissue in every part of the body is perfused. Essential nutrients
Why is the use of condoms not just a contraceptive method but also a health protection behavior? The use of condoms besides being an efficient contraceptive method also helps
Explain the Methodology for seliwanoff test? Take 5 ml of seliwanoff's reagent in a test tube. Add 5-6 drops of the glucose solution and heat the mixture to boiling for about 3
Which are plant tissues that form the plant roots? Roots have a central portion called medulla made of vascular tissue outer phloem and inner xylem. Medulla is delimited by per
Hypoglycaemia is defined as state of low blood glucose level of less than 50mg/dl. Low blood sugar level varies from person to person. Causes Since hypoglycaemia can occur in
Total Arterial Re-vascnlarisation : In total arterial re-vascularisalion (TAR) end of the right internal mammary artery (RIMA) or radial arlery (RA) is anastomosed to the side of
Discuss the similarities and differences of transposable elements in E. coli, yeast, plants, and Drosophila.
what is gaseous exchange
What is criminal law? Criminal law: A crime is an offence against society that accepted behaviours and is illegal by law. These all persons accused are prosecuted through
Once the decision to start drug treatment of hypertension is made, the aim should be to provide 24 hour BP control, with agents that would encourage patient adherence. The patient
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd