Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
AMPHE T AMINE S - Commonly called pep pills or antisleep drugs. They increase physical & mental performance. Taken by truck drivers, student & night workers to keep
Plague Plague is an acute and highly fatal disease caused by Yersinia pestis and transmitted by the bite of infected rat fleas. It is primarily a disease of rodents and small
Venipuncture : patient should be seated or supine for at least 20 minutes before sampling. An arm with an inserted intravenous line should be avoided. The median cubi
Oxidation of glyceraldehyde-3-phosphate Oxidation of glyceraldehyde-3-phosphate : The conversion of glceraldehyde- 3-phosphate to 1,3-bisphosphoglycerate is catalysed by
It is the preparatory phase. Cell organelle replicate and size of the cell increases. DNA molecule undergoes replication. Each chromosome exists as a pair of chromatids joined toge
Q. Write the meaning of diabetes mellitus? The word "diabetes" is from the Greek word meaning "a siphon". Diabetes patients had polyuria (passing excessive urine) and "pass it
What happens to respiratory system in a man going up a hill?
State the terms - Blastocoel and Blastopore? During the development of embryo, single cells divide and form a hollow ball of cells one cell layer thick. Cavity inside this holl
You are studying how proteins are targeted to the mitochondria. MIP1 is in the mitochondrial inner membrane, whereas MIP2 is targeted to the matrix. You are most interested in how
Define Flow Phase in Physiological Response to injury? It is characterized by hyper metabolism, increased cardiac output, increased urinary nitrogen losses, altered glucose met
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd