Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Why can crossing of an individual that manifests dominant phenotype with another that manifests recessive phenotype (for the same trait) determine whether the dominant individual i
Search the web (mainly IEEE and ACM) publication databases to find a recent article on a biomedical application using a microcontroller. Clearly cite your reference(s). In your
Various proteins are free to take a move laterally in the plane of the bilayer. One experiment used to represent this included fusing cultured mouse cells with human cells under ap
how does a cell formed
How do the sodium and potassium ions maintain the resting potential of the neuron? The plasma membrane of the neuron when at rest maintains an electric potential difference amo
Q. As a result of the DNA replication two DNA molecules come into existence. Why is it not correct to assert that the two "new" DNA molecules are created? What is the name given to
DISORDER S OF MALE REPRODUCTIVE SYSTEM (i) Prostatomegaly - Enlargment of prostate gland. It causes difficult & painful micturition. (ii) Impotence - Inability of male
what is class sarcodina
Coagulation - Blood Collection : Plasma is used to minimize the time needed for coagulation so it is used is medical emergencies. There are many types of anticoagulants used
What are the Grain boundaries Grain boundaries disrupt the motion of dislocations by a material, so reducing crystallite size is a common way to improve strength. Since grain b
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +1-415-670-9521
Phone: +1-415-670-9521
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd