Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Neurons, what are the properties of synapses

what are the properties of synapses

Explain fats, Explain Fats Fats: As you are already aware,  fats are ...

Explain Fats Fats: As you are already aware,  fats are reservoir  of  calories. In  addition  to carbohydrates,  fats can  also be  an important  source of  needed calories.

What is lymphatic network, What is Lymphatic Network? The lymphatic net...

What is Lymphatic Network? The lymphatic network consists of the lymphatic vessels, which circulate lymph throughout the body. Lymph is a liquid which carries out exchange of g

Pathogenesis of viruses, Pathogenesis of Viruses Viral diseases An...

Pathogenesis of Viruses Viral diseases An indicated before, viruses cause a number of infectious human diseases from minor ailments like common cold, to fatal disease, lik

#classification of parasitic protozoa.., most recent classification of para...

most recent classification of parasitic protozoa with its general characters

Show the physical criteria of quality for honey, Q. Show the Physical crite...

Q. Show the Physical criteria of quality for Honey? Colour, crystallization, pH, acidity, water content are some of the criteria used for analysis of honey. These criteria are

Invertebrate zoology, give an example invertebrate phylum/phyla for protopl...

give an example invertebrate phylum/phyla for protoplasmic grade organization

Tissue distribution and regulation of calcium concentration, Define Tissue ...

Define Tissue Distribution and Regulation of Calcium Concentration? As already discussed, development and preservation of bone mass is quantitatively an important function of c

Sea Lampreys, #questiHow do the non parasitic lampreys interact with other ...

#questiHow do the non parasitic lampreys interact with other members of their ecosystem in comparison to their parasitic cousinson..

Define classification of proteins on the basis of attributes, Define Classi...

Define Classification of proteins on the basis of attributes? Besides classifying proteins on the basis of soluble and insoluble, proteins have been further classified based on

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd