Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
METABOLISM - Word given by Shwann . It includes bio-chemical reactions occur in body may be constructive or destructive. It includes - Anabo
Tingling or numbness is seen in cases of neuropathy. It occurs gradually over time. As high sugar (glucose) in the blood damages the nervous system, particularly in the extremities
locomotion in amoeba
What is the difference between the lateral and the apical buds of the plants? Lateral buds are portions of meristematic tissue situated in the base of the shoots. Apical bud
OBJECTION OF CELL THEORY (REASONS OF DISCARTION) (i) Living organism are composed of various types of cells and their product but members of monera & protista don't have
Define phases of the absorption of iron? The process of absorption is divided into three phases: i) Iron uptake by enterocytes (epithelial cell of the superficial layer of t
Homologous series A homologous series can be illustrated as a group of compounds in which the several members have similar structural features and identical chemical propertie
Q. Assets and capital stock accounts? At the present extend the liabilities, assets and capital stock accounts in the Adjusted Trial Balance columns to the Balance Sheet column
Q. Describe Sensory Receptors? Receptor organs can detect external or internal stimuli. They can be classified according to the stimulus to which they respond: • Photorecep
What are the Abnormalities of gaze Normal gaze is when visual axes both eyes are parallel in primary gaze. when visual axes are not parallel in primary gaze, it is abnormal ga
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd