Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Metabolism, METABOLISM  - Word given by Shwann . It includes bio-ch...

METABOLISM  - Word given by Shwann . It includes bio-chemical reactions occur in body may be constructive or destructive. It includes -                         Anabo

Tingling or numbness in hands - symptoms of diabetes, Tingling or numbness...

Tingling or numbness is seen in cases of neuropathy. It occurs gradually over time. As high sugar (glucose) in the blood damages the nervous system, particularly in the extremities

Ameoba, locomotion in amoeba

locomotion in amoeba

Explain the lateral and the apical buds of the plants, What is the differen...

What is the difference between the lateral and the apical buds of the plants? Lateral buds are portions of meristematic tissue situated in the base of the shoots. Apical bud

Objection of cell theory, OBJECTION OF CELL THEORY (REASONS OF DISCARTION) ...

OBJECTION OF CELL THEORY (REASONS OF DISCARTION) (i)       Living organism are composed of various types of cells and their product but members of monera & protista don't have

Define phases of the absorption of iron, Define phases of the absorption of...

Define phases of the absorption of iron? The process of absorption is divided into three phases: i) Iron uptake by enterocytes (epithelial cell of the superficial layer of t

Homologous series, Homologous series A homologous series can be illust...

Homologous series A homologous series can be illustrated as a group of compounds in which the several members have similar structural features and identical chemical propertie

Assets and capital stock accounts, Q. Assets and capital stock accounts? ...

Q. Assets and capital stock accounts? At the present extend the liabilities, assets and capital stock accounts in the Adjusted Trial Balance columns to the Balance Sheet column

Describe sensory receptors, Q. Describe Sensory Receptors? Receptor org...

Q. Describe Sensory Receptors? Receptor organs can detect external or internal stimuli. They can be classified according to the stimulus to which they respond: • Photorecep

What are the abnormalities of gaze, What are the Abnormalities of gaze ...

What are the Abnormalities of gaze Normal gaze is when visual axes both eyes are parallel in primary gaze. when visual axes are not parallel in primary gaze, it is abnormal ga

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd