Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Risk during crown removal -Tooth inadvertently extracted using a crown\bridge remover . -Endodontic therapy was performed , and the tooth was replanted , a procedure known
State Bioinert materials Bioinert materials are chemically inert in the body and exhibit minimal chemical interaction with adjacent tissue such as titanium and alumina (Al 2 O
SULPHUR The major sources of sulphur are crucifers and animal proteins. Proteins present in pulses have little sulphur. Therefore, other vegetable proteins or crucifers must
Acetylcholine, a well known neurotransmitter, plays a critical synaptic role in the initial formation of memory. Chemical blockage of the acetylcholine receptors makes it harder to
explain glycolysis briefly? elaborate
Genes and Alleles The inheritance of any character can be studied only when thcre are two contrasting conditions, such as yellow versus green seed colour (as observed by Mendel
What are the Cardiac muscles We know that the heart muscles (cardiac muscles) are not under the control of mind. The day we are born, it starts its activity and the day peopl
A mother has brought her 2-week-old infant to the emergency department due to the baby's persistent and increasing jaundice. Blood testing reveals that the infant's unconjugated bi
PITUITARY DISORDERS - (a) Pituitary Dwarfism . It is caused by the deficiency of growth hormones (GH) from childhood. It is characterised by small but well porportioned body a
Explain Assessment of Iron Status? In view of widespread iron deficiency, it is important to have reliable and sensitive measures of iron status. Iron status can be assessed by
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd