Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Involution - Internalization of Mesoderm As by now mentioned, in the frog Xenopus (and probably in other amphibian species as well) the cells of presumptive mesoderm are in t
Q. What is coronary disease? The Coronary disease, or the coronary insufficiency, is a disease in which there is total or partial obstruction of one or more of the arteries tha
DISORDER S OF THE PANCREAS - (i ) Diabetes mellitus (Hypoinsulinism) The insulin-dependent diabetes mellitus (IDDM) is caused by a failure of the Beta-cells to produc
Define the Functions of Vitamin E? Vitamin E is the major lipid-soluble antioxidant in the cell antioxidant defence system and is exclusively obtained from the diet. The main r
Tumor Suppressor Genes Tumor suppressor genes or anti-oncogenes generally inhibit cell division in cooperation with proto-oncogenes. The very existence of these genes prevent
Starch It is a plant polysaccharide synthesized by the plant by photosynthesis and stored mainly in grains, legumes, roots and tubers. Its molecular formula is (C 6 H 1
What are the differences b/w bone and cartiledge
Increase in population size is known as population growth. It depends upon number of persons added to the population and number of persons lost from the population. Addition in pop
COMMON DISEASE OF GOATS - 1 . ANTHRAX 2 . FOOT & MOUTH DISEASE 3 . CONTAGIOUS PNEUMONIA - Characterized by pneumonia & pleurisy, cough, snee
Q. Despite having a great biodiversity why is the Amazon Rainforest under risk of desertification? The natural soil of the Amazon Rainforest isn't very fertile but it is enrich
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd