Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Illustrate Nernst equilibrium potential for potassium ions A complete motor neuron is removed from a frog and placed in normal physiological saline at 1 AM. The neuron is hea
However, according to conventional principles of economic analysis it is necessary that a resource is used for it to acquire a value. Consequently economists traditionally value bi
Difference between unconditioned and conditioned reflex action- S.NO . 1. UNCONDITIONED It is inborn CONDITIONED
What are caloreceptors
locomotary organ in mollusca
The Protein synthesis is very significant because it is by the use of genetic information to synthesize proteins in which the genes in the DNA are expressed in the phenotype. Make
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Board spectrum antibiotics are effective against several diff. types of harmful bacteria ex: tetracycline
Butylated hydroxyanisole (BHA) It is commercially available as a mixture of two isomers and has found wide commercial use in the food industry. It is highly soluble in oil and
Diastolic dysfunction is responsible for one third of cases of heart failure alone and rest two third of cases in combination with systolic dysfunction. Diastolic dysfunction c
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd