Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

List the types of gellan gum, List the types of Gellan gum.   The three...

List the types of Gellan gum.   The three types of gellan gums are: High acetyl gellan (partially deacetylated) Low acetyl gellan (highly deacetylated) High cl

Write the meaning of gestational diabetes mellitus, Q. Write the meaning of...

Q. Write the meaning of Gestational Diabetes Mellitus? Gestational Diabetes Mellitus (GDM) is defined as glucose intolerance of any severity that has its onset or is first reco

Smoking of meat products, S m o k in g of Meat Products The purpos...

S m o k in g of Meat Products The purpose of smoking meat is to develop a distinctive flavour, aroma and appearance. These attributes can also be achieved with liquid smok

Single pair of alleles, Give three examples of human disorders which are ca...

Give three examples of human disorders which are caused by the action of a single pair of alleles. In every case say whether the harmful allele is dominant or recessive to the non-

Objectives of the earth pressure and retaining structures, What are the obj...

What are the objectives of the earth pressure and retaining structures? After knowing all concepts about the same you should be able to learn: a. Know the field situations w

Explain kingdom monera, Kingdom Monera The monerians are structurally t...

Kingdom Monera The monerians are structurally the simplest of all living things. They have apparently changed little since they first appeared on the earth. Their structure is

How phytohormones help development of parthenocarpic fruits, How phytohormo...

How phytohormones help the development of parthenocarpic fruits? The Parthenocarpic fruits are those produced with no fecundation. Several plants naturally make parthenocarpic

Explain about natural pigments, Explain about natural pigments There ha...

Explain about natural pigments There has been an extensive search of the microbial, plant and animal kingdoms for pigments that possess both high tinctorial power/strength (a m

What essential function do serve, Why do membranes figure so prominently in...

Why do membranes figure so prominently in eukaryotic cells? What essential function do they serve?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd