Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Green leaves make food for plants Heat some alcohol in a jar over boiling water unless it boils. Break various green leaves from a geranium or other plant which has been in the
this is animal?
Apomictic embryos in citrus arise from: 1. Synergids 2. Maternal sporophytic tissue in ovule 3. Antipodal cells 4. Diploid egg Maternal sporophytic tissue in ovule
Q. Aortic regurgitation by Cardiac Catheterization? Often cardiac catheterization is not indicated as reliable information for management decision making can be obtained throug
Determine the functional brain activity PET is powerful means of assessing functional brain activity, although it does not directly measures neuronal events. Rather it indicate
What are the possible sources of human embryonic stem cells? Embryonic stem cells can be derived from individual cells of an early embryo, from blood cells in the umbilical co
Q. What is predatism? The Predatism is the ecological interaction in which one individual kills or mutilates another to get food. The Predatism is an inharmonious (negative) ec
Explain the main function of the digestive system The major function of the digestive system is to ingest the food materials, digest it to absorbable end products, absorb the
BUCCAL CAVITY - Situated between upper & lower jaw. It is lined by stratified squamous epithelium. Separated from nasal chamber by palate. Palate forms roof of buccal cav
What are the chemical substances formed by water photolysis? What is the destination of each of those substances? Free electrons, hydrogen ions and molecular oxygen are liberat
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd