Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What do we mean by fixation? Fixation is the process of preserving internal and external structures of microorganisms. It leads to the killing of microbial cells and their fir
Resistance Acyclovir-resistant HSV occurs mainly in immunocom- promised patients treated with the drug; isolates are usually also resistant to valacyclovir and famciclovir. Re
Anterior superior alveolar nerve It is a branch of infraorbital nerve which arises within the infraorbital canal. It gives a nasal branch which passes into nasal cavity to supp
Aves has a nucleated rbc or not???
What is cytoskeleton? What are its main constituents in animal cells? Ans) Cytoskeleton is the cytoplasmic structure that handles the cell, keeps its shape and fixates and moves
Q. Etiologic factor of Congestive Cardiac Failure? Congestive heart failure develops over a period of time when the necrotic tissues are not replaced by functional connective c
Neo-zoonoses In recent times, some of the pre-existing low profile and less frequent zoonoses and some entirely newly recognized zoonoses are emerging with a new dimension. Th
Q. Which is the kingdom of the parasites that cause malaria and Chagas' disease? Those maladies are caused by the protozoans, beings of the kingdom Protista. Q. What is the
What are the environmental harms caused by mercury pollution? What are the main sources of mercury pollution? Mercury is a metal that when present in the water of lakes, river
Ammonia Assimilation - Inorganic Nitrogen and Sulphur Metabolism Nitrogen (N 2 ) gas and NO 3 are the most common available forms of inorganic nitrogen. Both are enzymaticall
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd