Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Animal biodiversity, discuss why obelia is considered to be of special inte...

discuss why obelia is considered to be of special interest in zoology as an animal showing an intermediate grade of organisation

Explain the buccal perforations, Buccal Perforations Buccal concavitie...

Buccal Perforations Buccal concavities in the bone can result in some threads of the implant being exposed. Where these are very circumscribed and covered with thick and well-

What are colonies and societies, Q. What are colonies and societies? Th...

Q. What are colonies and societies? The Colonies are functional integrated aggregates formed by individuals of the similar species. The Colonies are often confused with a singl

What is the ecological role of earthworms, Q. What is the ecological role o...

Q. What is the ecological role of earthworms? Earthworms have an important ecological role as they eat decomposing organic material. They also dig tunnels in the subsoil allowi

Explain role of messenger the ribosomes, Q What is the role of messenger th...

Q What is the role of messenger the ribosomes and RNA for the protein synthesis? The mRNA is produced within the cellular nucleus and migrates to the cytoplasm where associated

Define types of dryers, Define types of Dryers? There are many other dr...

Define types of Dryers? There are many other dryer types available, such as; Osmotic Drying Impingement Drying Microwave and Dielectric Drying Superheated

What is critical photoperiod, What is critical photoperiod? And How can the...

What is critical photoperiod? And How can the critical photoperiod relate to flowering be experimentally determined? Critical photoperiod is the limit of the photoperiod durati

Define important points while working with autoclave, Define Important Poin...

Define Important Points While Working With Autoclave? Note: Following points should be kept in mind while working with autoclave. 1. Autoclave should not be packed tightly o

Explain the types of fats, Jillian and Michael are in their freshman year a...

Jillian and Michael are in their freshman year at college. The two have been friends since grade school and the two of them enjoy getting together for dinner. Michael typically

Determine what is the Cell Cycle, The cell cycle undergoes a sequence of ch...

The cell cycle undergoes a sequence of changes which involve a period of growth replication of DNA, Followed by cell division. This sequence of changes is called cell cycle.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd