Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define the effects of Deficiency of Calcium in the Body? If there is a continued inadequate intake or poor intestinal absorption of calcium, plasma calcium concentrations will
Q. How mineral salts participate in enzymatic activity? Many mineral salts are cofactors of enzymes that are the substances without which enzymes do not work.
Concerning their biological function what is the difference between DNA and RNA? DNA is the source of information for RNA production (transcription) and therefore for protein s
Explain Principle of Fehling's Soxhlet method (Lane-Eynon method)? Reducing sugars are those which have free sugar groups and hence may be estimated directly by titrating the s
Define effect on Human placental lactogen in pregnancy? Human placental lactogen, with a structure similar to the growth hormone, increases throughout pregnancy. Its rate of pr
Q. What is proteinuria? Why is proteinuria a sign of glomerular renal injury? Proteinuria means losing of proteins through urine under normal conditions proteins are too big to
HOW ARE THE ORIGIN AND EVOLUTION OF ALGAE..
Explain the Toxicity of nicotinic acid? Although therapeutically useful in lowering serum cholesterol, administration of chronic high oral doses of nicotinic acid can lead to h
Determination Reductive hydrolysis of folic acid produces 4-aminobenzoyl glutamic acid which is determined photometrically after diazotization and coupling with N-(1-naphthyl)
Q. How is the circulatory system of reptiles characterized? What is the basic difference between the amphibian and the reptile heart? The circulatory system of beings of the cl
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd