Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Meningocele In this the meninges protrude through the opening in the vertebrae generally in the lower back. The sac contains meninges and cerebrospinal fluid. The sac may
How Simple Transposition of the Great Arteries Present after 30 Days ? A switch operation will have poor results, as the ventricle that has regressed will not be able to mainta
WHAT IS NUCLEAR DIAMORPHISM?
Definition of a neuropsychological test The best definition of a neuropsychological test has been offered by Ralph Reitan, who described it as a test that is sensitive to the
A solute passes from higher concentration on the left of a container to the right side of container thru a membrane. What would happen if a second solute of lower concentration was
In the sarcomere of a skeletal muscle, there are A. myosin molecules in the I band. B. both tropomyosin and myosin molecules in the region of the A band that is not in the H
Q. What are the Symptoms of acute pericarditis? Chest Pain Chest pain is the most important symptom. It is retrosternal in location and patient usually locates the site o
Q. Do the amine and the carboxyl groups attached to central carbons participate in the union between amino acids? Yes. The nitrogen of the amine group of one amino acid binds t
Brain Brain is a part of central nervous system which lies in the skull. Source: Sears and Windwood, Anatomy and Physiology for Nurses The different parts of the bra
role of bioenergetics in our body
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd