Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Which factors are altered when cells are moved from an in vivo to an in vitro environment, and how do cells respond to these changes?
St. Jude Medical Valve (SJM) : This is a low profile bi-leaflet valve, which was introduced in 1977. The leaflets and the housing are made of pyrolitic carbon. The currently
Q. Describe the metabolism of lipids? Fats are split into fatty acids and glycerol by the enzyme. They are absorbed in small intestine and recombined into fats. It is stored in
What are some similarities between proteins, carbohydrates, and nucleic acids?
Protoplasmic Streaming and Tubular Peristaltic Flow Model The first of the above two models involves the well known phenomenon of cytoplasmic streaming in giant algal cells. C
When the R-wave in the lateral precordial leads is less than 10 mm the sensitivity of ST depression is very low if 1 mm of ST depression is used as a standard. The corrected ST for
Theories are import because they can be used to a. Test research hypothesis b. Develop questions which will facilitate more effective research c. Conduct more meaningful and useful
Ultrasonic and sonic vibrations Cells of all types can be destructed by intense sonic and ultrasonic vibrations generated by magnetostrictive oscillations or peizo electric cry
Antibody Structure: An antibody molecule consist of two alike light chains ( 220 amino acids each) ad two similar heavy chains (about 440-450 amino acids each) held together
Q. What are the major significant organic molecules for living beings? There are many types of organic molecules that are important for the living beings. Particularly importan
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd