Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

What is weaning from mechanical ventilation, What is Weaning from Mechanica...

What is Weaning from Mechanical Ventilation? It is crucial to get the timing just right as to when to discontinue mechanical ventilation and extubate. If too early, this might

What are the products and reagents of fermentation, Q. In general what are ...

Q. In general what are the products and reagents of fermentation? In fermentation glucose sugar is degraded into pyruvic acid each glucose molecule forms two pyruvic acid molec

Impulse transmission, The conduction of impulse in a nerve fibre is. a elec...

The conduction of impulse in a nerve fibre is. a electrochemical process. Maximum speed of transmission of nerve impulse can be 13 metre/second due to axoplasm is much resistant to

Define method used for capsular staining - anthony staining, Define method ...

Define method Used for Capsular Staining - Anthony Staining Method? Another method used for capsular staining is Anthony staining method, devised by E.E. Anthony in 1931. The m

How have brain-imaging methods such as pet and mri, How have brain-imaging ...

How have brain-imaging methods such as PET and MRI affected neuroscience research and clinical care? Techniques which capture pictures of the living human brain at work have be

What is molting, What is Molting? Explain in brief. The periodic sheddi...

What is Molting? Explain in brief. The periodic shedding of outer body covering of an animal. The term is applied to a variety of things including: loss of the outer exoskeleto

Cell, The scientist who described cells as “many little boxes” was

The scientist who described cells as “many little boxes” was

Explain casein, Explain Casein Casein is an important example of protei...

Explain Casein Casein is an important example of protein, which can be boiled without apparent change in stability. The exceptional stability of casein makes it possible to boi

What was lamarcks explanation for the succession, What was Lamarck's explan...

What was Lamarck's explanation for the succession of fossils in a given location? ps: I want to the idea for the succession of fossils, not the whole difference between Darwin and

Show the symptoms of salmonellosis, Q. Show the Symptoms of salmonellosis? ...

Q. Show the Symptoms of salmonellosis? Symptoms: The susceptibility of humans varies with the species and strains of the organism and the total number of bacteria ingested. A

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd