Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the adverse effects of rifamycin, Adverse effects of rifamycin  ...

Adverse effects of rifamycin  No severe adverse effects were observed in clinical trials with rifaximin. There have been a few postmarketingeports of hypersensitivity reactions

Amphibians, respiratory system in amphibains

respiratory system in amphibains

Breifly describe the menstrual cycle, Breifly describe the Menstrual Cycle?...

Breifly describe the Menstrual Cycle? Each month during a female's reproductive years, the hypothalamus secretes a hormone that stimulates the anterior lobe of the pituitary gl

Transcription of a eukaryotic protein-coding gene, 1. Describe how the vari...

1. Describe how the various molecular mechanisms act to regulate transcription of the genes within the lactose operon of E. coli . 2. Transcription of a eukaryotic protein-codi

Virus is in an inactive state, Q. What is signifying when it is said that a...

Q. What is signifying when it is said that a virus is in an inactive state? Viruses considered in inactive state are those whose genetic material is within host cells without a

What is cost effective analysis, What is Cost Effective Analysis? Cost ...

What is Cost Effective Analysis? Cost effective analysis: Cost effective analysis provides for the choice of least expensive strategy at the least cost. Here the outcome is mea

Determine the sodium-potassium atpase pumps, A normal healthy cell is bathe...

A normal healthy cell is bathed in a normal extracellular saline.  The plasma membrane of the cell contains voltage-gated sodium channels, sodium-glucose co-transporters, and sodiu

What is absorption, What is absorption?   Absorption involves  the  tr...

What is absorption?   Absorption involves  the  transfer of materials  through  the mucosa of the  alimentary tract  into blood and lymph vessels.

Geology LAB, Can you guys help with my homework assignment for Geology?

Can you guys help with my homework assignment for Geology?

Which chemical causes tooth destruction, The bacteria that cause dental cav...

The bacteria that cause dental cavities in humans break down sugars, releasing what chemical which causes tooth destruction? a) Acids b) Bases c) Enzymes d) Monosaccha

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd