Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Biodiversity maintains the air we breathe and the water we drink. Green plants purify our air and our water by taking in carbon dioxide, regulating water vapour, releasing oxygen,
Which of the following best explains what would happen if recombination (crossing-over) happens during mitotic prophase? A. Recombination during mitosis will lead to segregatio
In the previous sub-section we discussed the possible ways by which variabiliti can, be generated. We shall now examine one instance that illustrates the consequence of variability
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
If the generation time (t) is the incubation time (t) per generation (G), or t = t/G, rewrite the formula you derived in question 2 for bacterial population growth in terms of incu
Q. What is an instance of a hypothesis which may explicate why there is not a big representation of the class Reptilia found in Polar Regions? Beings of the class Reptilia are
Meat products Meat is an important commodity in the diet of people in view of its complimentary role in balancing the diet with rich source of amino acids, vitamins and mineral
After the food intake is over, the food gets digested, assimilated and finally egested through the kidneys and anus. The urinary system: • Filters waste materials from the blood
What is Metachronal wave? Describe. During the coordination of the ciliary movement, bands, or groups of cilia, are at different stages of their beating pattern, and this creat
Water Adaptations After becoming familiar with the two kinds of water stresses you would like to know about the adaptations in plants and animals which enable them to survive u
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd