Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
A person with a cough takes a patent cough syrup. In three days, the cough is better. Does this mean that the syrup has cured the cough? Justify your answer. There is insuffic
how do retroviruses reproduce?
SUBERIN It is a lipid formed by esterification of phellonic acid or its derivative with glycerol. Suberin occurs in the walls of cork cells and endodermal cells. It makes
Q. What are the main biological functions of water? Water is the basic solvent for chemical reactions of living beings; it is the main means of substance transportation in the
When glucagon binds its receptor there is an increase in the second messenger, cAMP. cAMP levels can be decrease by which of the following enzymes? -adenylate cyclase -PDK1
Behavior means responses or reactions or acting in any situation. Change means act of changing or to become different or to modify. Behaviour Change can refer to any modifica
Will the plant-incorporated protectants rules affect the Bt reassessment? No. To make sure that our biotechnology assessments reflect the latest data on health and ecological e
REFLE X ACTION - Marshel Hall discovered reflex action. Best & Taylor defined it. Reflex action is functional unit of CNS. It is sudden, immediate involuntary acti
INTRODUCTIO N - Karl Von Baer - Coined the term cleavage. Swammerdom - First time seen cleavage. Prevost and Dumas - Reported cleavage of frog's egg. Spllanzani - Detail
#q1. If offspring exhibit a 3:1 phenotypic ratio, what are the genotypes of a parent?uestion..
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd