Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is the life cycle of Trypanosoma cruzi? Trypanosoma cruzi is a heteroxenous parasite, i.e., it has an intermediate host, the triatomine bug, and an ultimate host, the hum
case study
DIFFERENCE S BETWEEN HYPOTHESIS AND THEORY - 1. Hypothesis It is a reasoned or educated guess about a 1.
Empyema: Empyema is accumulation of thick pus in the pleural cavity. Primary infection of pleura does not arise so the pathology may either be in chest wall, mediastinum or t
Which of the following pairs of functional groups CANNOT react with each other by a dehydration reaction? Select one: a. Carboxyl;Hydroxyl b. Carboxyl;Sulfhydryl c. Pho
why is it necessary to grind the food samples before testing?
Explain Gelatin - Tests for Presence of Exoenzymatic Activity? Gelatin is an incomplete protein as it lacks amino acid tryptophan. It is a major component of connective tissue
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
What is ribose Browning in canned fish is commonly associated with ribose. Undesirable colour changes in shellfish during canning often involve metal ions, for example, the bl
What is the mRNA sequence to this DNA sequence : Guanine, cytosine, adenine, adenine, thymine, guanine
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd