Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
discuss why obelia is considered to be of special interest in zoology as an animal showing an intermediate grade of organisation
Buccal Perforations Buccal concavities in the bone can result in some threads of the implant being exposed. Where these are very circumscribed and covered with thick and well-
Q. What are colonies and societies? The Colonies are functional integrated aggregates formed by individuals of the similar species. The Colonies are often confused with a singl
Q. What is the ecological role of earthworms? Earthworms have an important ecological role as they eat decomposing organic material. They also dig tunnels in the subsoil allowi
Q What is the role of messenger the ribosomes and RNA for the protein synthesis? The mRNA is produced within the cellular nucleus and migrates to the cytoplasm where associated
Define types of Dryers? There are many other dryer types available, such as; Osmotic Drying Impingement Drying Microwave and Dielectric Drying Superheated
What is critical photoperiod? And How can the critical photoperiod relate to flowering be experimentally determined? Critical photoperiod is the limit of the photoperiod durati
Define Important Points While Working With Autoclave? Note: Following points should be kept in mind while working with autoclave. 1. Autoclave should not be packed tightly o
Jillian and Michael are in their freshman year at college. The two have been friends since grade school and the two of them enjoy getting together for dinner. Michael typically
The cell cycle undergoes a sequence of changes which involve a period of growth replication of DNA, Followed by cell division. This sequence of changes is called cell cycle.
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd