Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Adverse effects of rifamycin No severe adverse effects were observed in clinical trials with rifaximin. There have been a few postmarketingeports of hypersensitivity reactions
respiratory system in amphibains
Breifly describe the Menstrual Cycle? Each month during a female's reproductive years, the hypothalamus secretes a hormone that stimulates the anterior lobe of the pituitary gl
1. Describe how the various molecular mechanisms act to regulate transcription of the genes within the lactose operon of E. coli . 2. Transcription of a eukaryotic protein-codi
Q. What is signifying when it is said that a virus is in an inactive state? Viruses considered in inactive state are those whose genetic material is within host cells without a
What is Cost Effective Analysis? Cost effective analysis: Cost effective analysis provides for the choice of least expensive strategy at the least cost. Here the outcome is mea
A normal healthy cell is bathed in a normal extracellular saline. The plasma membrane of the cell contains voltage-gated sodium channels, sodium-glucose co-transporters, and sodiu
What is absorption? Absorption involves the transfer of materials through the mucosa of the alimentary tract into blood and lymph vessels.
Can you guys help with my homework assignment for Geology?
The bacteria that cause dental cavities in humans break down sugars, releasing what chemical which causes tooth destruction? a) Acids b) Bases c) Enzymes d) Monosaccha
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd