Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Define Serum Vitamin A Content? Assessment of serum vitamin A content is the most reliable criterion Tor assessing vitamin A status. Serum levels indicative of various degrees
A calico female has a litter of kitten which includes several calico females a yellow male a couple of yellow females and two black males what is the likely color of the father and
You have accidentally mixed up 3 beakers of solutions. One is water. One is pure methanol. One is pure phosphoric acid. What would be a very wrong way to tell the difference betwee
The heart is the muscular pump that pushes blood through the circulatory system. Each heartbeat can be felt as an arterial pulse. The heart valves when closed prevent the blood fro
Name the enzyme present in saliva and say what type of food it acts on. The enzyme in saliva is salivary amylase and it acts on starch.
Q. Phylogenetic species concept ? Taxonomists (scientists who compare, classify and name organisms) tend to describe a species by studying their physical characteristics and be
excretory system in agama lizard
1) The presence of epicardial coronary artery stenosis caused by artherosclerotic plaques is by far the most frequent angiographic finding in any cardiac ischaemic syndrome. 2)
Differences between cells of Prokaryotes and Eukaryotes The prokaryotes also differ from the eukaryotes in many other ways, as you can see from Table. Table: Differences
Birth control pills maintain a high blood level of estrogen and progesterone. What is happening in the ovary when the blood level of estrogen is high? How is the uterus responding?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd