Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain the Uses of ISP in Infant formulas Infant formulas Infant formulas, where milk solids have been changed by soy products, are well established commercial products
In eukaryotes, the electron transport and oxidative phosphorylation occurs in the inner membrane of mitochondria. These processes re-oxidize the FADH 2 and NADH which comes
What is the spontaneous generation hypothesis? The impulsive generation abiogenesis or hypothesys asserts that life on earth has come from nonliving material. For instance, t
The Cori cycle a) Pyruvate formed from glucose is converted to lactate by lactate dehydrogenase in the muscle cell. b) Lactate is released into the blood and taken up b
Periimplant Probing Depth In contrast to natural teeth, for which the average periodontal probing depth (PD) has been reported, the physiologic depth of the periimplant sulcus
What the difference is between type I diabetes mellitus and type II diabetes mellitus? Type I diabetes, also called as juvenile diabetes, or insulin-dependent diabetes (this na
Nutrition
Hydrolytic driving force. The hydrolysis of pyrophosphate to orthophosphate is important in driving forwards biosynthetic reactions such as the synthesis of DNA. THis hydrolytic re
Explain in brief about the diseases Sleep paralysis This is an episode of paralysis in the transition between wakefulness and sleep. The period of paralysis is usually brief bu
Double helical structure of dna
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd