Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
What is Weaning from Mechanical Ventilation? It is crucial to get the timing just right as to when to discontinue mechanical ventilation and extubate. If too early, this might
Q. In general what are the products and reagents of fermentation? In fermentation glucose sugar is degraded into pyruvic acid each glucose molecule forms two pyruvic acid molec
The conduction of impulse in a nerve fibre is. a electrochemical process. Maximum speed of transmission of nerve impulse can be 13 metre/second due to axoplasm is much resistant to
Define method Used for Capsular Staining - Anthony Staining Method? Another method used for capsular staining is Anthony staining method, devised by E.E. Anthony in 1931. The m
How have brain-imaging methods such as PET and MRI affected neuroscience research and clinical care? Techniques which capture pictures of the living human brain at work have be
What is Molting? Explain in brief. The periodic shedding of outer body covering of an animal. The term is applied to a variety of things including: loss of the outer exoskeleto
The scientist who described cells as “many little boxes” was
Explain Casein Casein is an important example of protein, which can be boiled without apparent change in stability. The exceptional stability of casein makes it possible to boi
What was Lamarck's explanation for the succession of fossils in a given location? ps: I want to the idea for the succession of fossils, not the whole difference between Darwin and
Q. Show the Symptoms of salmonellosis? Symptoms: The susceptibility of humans varies with the species and strains of the organism and the total number of bacteria ingested. A
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd