Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Lipid profile, Abnormalities in the lipid profile are found in patients wit...

Abnormalities in the lipid profile are found in patients with diabetes mellitus. The lipid abnormalities increase the risk of heart disease in diabetics and hence should be regular

How membrane maintained impermeability to potassium, How membrane maintaine...

How membrane maintained impermeability to potassium At 1 AM, an impermeable membrane divides a 1 liter solution of 1M NaCl in the left compartment from a 1 liter solution havin

What phenotypic ratios of the diploid, A wild-type strain of haploid yeast ...

A wild-type strain of haploid yeast is crossed to a mutant haploid strain to make a diploid. What phenotypic ratios will be observed in the haploid progeny of the diploid?

What are the cells that produce the myelin sheath, What are the cells that ...

What are the cells that produce the myelin sheath? Of which substance is the myelin sheath formed? In the central nervous system (CNS) the myelin sheath is made by apposition o

What is selective waste collection, Q. What is selective waste collection? ...

Q. What is selective waste collection? The Recyclable waste is waste that can be reprocessed and used again. The waste recycling depends on the separation of the recyclable res

Tongue grafting, Tongue grafting Top of the stock is cut diagonally ...

Tongue grafting Top of the stock is cut diagonally and in an upward direction. Scion is cut diagonally in downward direction. A second cut is given from above downwards,

#tzoology, #affinities of ctenophora with platyhelmintheson..

#affinities of ctenophora with platyhelmintheson..

Describe atg or aug, ATG or AUG: The codon for the methionine; the transla...

ATG or AUG: The codon for the methionine; the translation initiation codon. generally, protein translation can only start at the methionine codon (although this codon might be fou

Explain the differance between savanna and desert, Explain the differance b...

Explain the differance between savanna and desert? Savanna : Savanna is characterized by relatively low rainfall and pronounced dry seasons. This type of climate produces a b

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd