Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Explain Feeding Schedule in Infancy? 1) Milk feed 5-6 times/day. Continue breast-feeding. Exclusive breast-feeding up to 6 months even during illness. Follow demand feeding.
State the Diagnosis and prevention of VIBRIO PARAHAEMOLYTICUS Diagnosis: Diagnosis of gastroenteritis caused by this organism is made by culturing the organism from the diarrh
Explain Continuous Murmurs and their characterstic in details? These murmurs are continuous throughout systole and diastole. It is due to continuous blood flow in the same dire
Explain Triangular Full Mucoperiosteal Flaps - Endodontic Surgery - Only vertical releasing incision with the Horizontal incision, -Used at the area of important anatom
what major nerve do you think is being compressed when a person often feel pain in the posterior surface of the thigh radiating to the area behind the knee and where is the likely
Q. Can you explain Shellfish Poisoning? Shellfish like oysters, mussels and clams are generally bred in the sewage polluted beds or brackish water. The shellfish poisoni
Enzyme Activity Enzymes are biomolecules which catalyze (i.e. increase the rates of) chemical reactions. Almost all enzymes are proteins. In enzymatic reactions, the molecules
Define the terms umbra and penumbra, and describe how they relate to solar eclipses.
It is IgE mediated hypersensitivity. Typical manifestations contain asthma, food allergies, eczema, hay fever etc.
Name of the ductless glands that secrete their product into the circulatory system are: a) Exocrine (pron: ek-seh-kren) b) Apocrine (pron: ap-eh-kren) c) Holocrine (pron:
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd