Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Illustrate nernst equilibrium potential for potassium ions, Illustrate Nern...

Illustrate Nernst equilibrium potential for potassium ions A complete motor neuron is removed from a frog and placed in normal physiological saline at 1 AM.  The neuron is hea

Traditionally value biological resources, However, according to conventiona...

However, according to conventional principles of economic analysis it is necessary that a resource is used for it to acquire a value. Consequently economists traditionally value bi

Difference between unconditioned & conditioned reflex action, Difference be...

Difference between unconditioned and conditioned reflex action- S.NO .   1. UNCONDITIONED   It is inborn CONDITIONED

Mollusca, locomotary organ in mollusca

locomotary organ in mollusca

Transcription of protein-coding genes in eukaryotes, The Protein synthesis ...

The Protein synthesis is very significant because it is by the use of genetic information to synthesize proteins in which the genes in the DNA are expressed in the phenotype. Make

Spore forming protozoan, Normal 0 false false false EN-...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Explain broad spectrum antibiotics?, Board spectrum antibiotics are effecti...

Board spectrum antibiotics are effective against several diff. types of harmful bacteria ex: tetracycline

Explain butylated hydroxyanisole, Butylated hydroxyanisole (BHA) It is ...

Butylated hydroxyanisole (BHA) It is commercially available as a mixture of two isomers and has found wide commercial use in the food industry. It is highly soluble in oil and

Assessment of diastolic function, Diastolic dysfunction is  responsible for...

Diastolic dysfunction is  responsible for one third of cases of heart  failure alone and rest two  third of cases in  combination with systolic dysfunction. Diastolic dysfunction c

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd