Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
List the types of Gellan gum. The three types of gellan gums are: High acetyl gellan (partially deacetylated) Low acetyl gellan (highly deacetylated) High cl
Q. Write the meaning of Gestational Diabetes Mellitus? Gestational Diabetes Mellitus (GDM) is defined as glucose intolerance of any severity that has its onset or is first reco
all about excretion
S m o k in g of Meat Products The purpose of smoking meat is to develop a distinctive flavour, aroma and appearance. These attributes can also be achieved with liquid smok
Give three examples of human disorders which are caused by the action of a single pair of alleles. In every case say whether the harmful allele is dominant or recessive to the non-
What are the objectives of the earth pressure and retaining structures? After knowing all concepts about the same you should be able to learn: a. Know the field situations w
Kingdom Monera The monerians are structurally the simplest of all living things. They have apparently changed little since they first appeared on the earth. Their structure is
How phytohormones help the development of parthenocarpic fruits? The Parthenocarpic fruits are those produced with no fecundation. Several plants naturally make parthenocarpic
Explain about natural pigments There has been an extensive search of the microbial, plant and animal kingdoms for pigments that possess both high tinctorial power/strength (a m
Why do membranes figure so prominently in eukaryotic cells? What essential function do they serve?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd