Sequence for the beta actin gene, Biology

Assignment Help:

The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').              

a)  Forward = ggctcacagcgcgcccggctat

      Reverse = taaaagtgcacaccttaaaaatga  

b)  Forward = tatcggcccgcgcgacactcgg

      Reverse = tcatttttaaggtgtgcactttta  

c)  Forward = ggctcacagcgcgcccggctat

      Reverse = tcatttttaaggtgtgcactttta  

d)  Forward = atagccgggcgcgctgtagcc

      Reverse = taaaagtgcacaccttaaaaatga  

Explain your reasoning


Related Discussions:- Sequence for the beta actin gene

Explain the uses of isP in infant formulas, Explain the Uses of ISP in Infa...

Explain the Uses of ISP in Infant formulas Infant formulas  Infant formulas, where milk solids have been changed by soy products, are well established commercial products

Oxidative phosphorylation occurs in the inner membrane, In  eukaryotes,  th...

In  eukaryotes,  the electron  transport  and oxidative phosphorylation occurs in the inner membrane of mitochondria.  These processes re-oxidize the FADH 2 and NADH   which comes

What is the spontaneous generation hypothesis, What is the spontaneous gene...

What is the spontaneous generation hypothesis? The impulsive generation abiogenesis or hypothesys asserts that life on earth has come from nonliving material. For instance, t

Explain the cori cycle, The  Cori cycle a)  Pyruvate formed from glucos...

The  Cori cycle a)  Pyruvate formed from glucose is converted  to lactate by lactate dehydrogenase in the muscle cell. b)  Lactate is released into  the blood and taken up b

Explain about periimplant probing depth, Periimplant Probing Depth In c...

Periimplant Probing Depth In contrast to natural teeth, for which the average periodontal probing depth (PD) has been reported, the physiologic depth of the periimplant sulcus

Explain the type I diabetes mellitus, What the difference is between type I...

What the difference is between type I diabetes mellitus and type II diabetes mellitus? Type I diabetes, also called as juvenile diabetes, or insulin-dependent diabetes (this na

What is the turnover number of the enzyme, Hydrolytic driving force. The hy...

Hydrolytic driving force. The hydrolysis of pyrophosphate to orthophosphate is important in driving forwards biosynthetic reactions such as the synthesis of DNA. THis hydrolytic re

Explain in brief about the diseases sleep paralysis, Explain in brief about...

Explain in brief about the diseases Sleep paralysis This is an episode of paralysis in the transition between wakefulness and sleep. The period of paralysis is usually brief bu

Dna, Double helical structure of dna

Double helical structure of dna

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd