Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
Question 1 Discuss the Following a) Immune response b) Immunofluorescence test and its applications Question 2 Answer the following ques
Natural Classification Natural classification is based on the natural characters of the taxa. Some consider natural classification a phylogenetic one reflecting the evolutionar
Q. What is the function of mineral salts in the creation of electric tension (voltage) at the cellular level? The electric activity of the cell, for example, in neurons, depend
Define Supplementation for prevention of vitamin A deficiency? Administration of large doses of vitamin A to children at risk has been the most popular approach to control nutr
What are the main harms caused by vitamin A deficiency? How does this vitamin act in the physiology of vision? Deficiency of vitamin A (retinol) might be cause night blindness
A Molecule of DNA is 2.17 um long. The ends of the molecule become strongly ionixed: negative on one end, positive on the other. The helical molecule acts like a spring and compres
how many grams of table sugar would you need to dissolved in water to produce 0.75 liters of a 0:25 molar acqeous solution of table sugar?
Explain the interaction of vitamin a with Proteins? Proteins: The protein status of an individual influences vitamin A status and transport because an inadequate protein intake
Assume that your yard has many tall trees that result in about fifty percent of the yard being shaded and fifty percent of the yard being exposed to full sun. The shaded areas and
How are the transparency and functions of cornea evaluated? Physiological roles of barrier function, refractive function (with interaction of tear film), response to wound and
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd