Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
The sequence for the Beta Actin gene (ACTB) is given below. Which pair of primers (designed to amplify the entire sequence below) could be used to successfully produce the beta actin PCR product. Circle your answer (note all sequences are written 5' to 3').
a) Forward = ggctcacagcgcgcccggctat
Reverse = taaaagtgcacaccttaaaaatga
b) Forward = tatcggcccgcgcgacactcgg
Reverse = tcatttttaaggtgtgcactttta
c) Forward = ggctcacagcgcgcccggctat
d) Forward = atagccgggcgcgctgtagcc
Explain your reasoning
what are the properties of synapses
Explain Fats Fats: As you are already aware, fats are reservoir of calories. In addition to carbohydrates, fats can also be an important source of needed calories.
What is Lymphatic Network? The lymphatic network consists of the lymphatic vessels, which circulate lymph throughout the body. Lymph is a liquid which carries out exchange of g
Pathogenesis of Viruses Viral diseases An indicated before, viruses cause a number of infectious human diseases from minor ailments like common cold, to fatal disease, lik
most recent classification of parasitic protozoa with its general characters
Q. Show the Physical criteria of quality for Honey? Colour, crystallization, pH, acidity, water content are some of the criteria used for analysis of honey. These criteria are
give an example invertebrate phylum/phyla for protoplasmic grade organization
Define Tissue Distribution and Regulation of Calcium Concentration? As already discussed, development and preservation of bone mass is quantitatively an important function of c
#questiHow do the non parasitic lampreys interact with other members of their ecosystem in comparison to their parasitic cousinson..
Define Classification of proteins on the basis of attributes? Besides classifying proteins on the basis of soluble and insoluble, proteins have been further classified based on
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd