Psychoactive substance use disorders, Biology

Assignment Help:

PSYCHOACTIVE SUBSTANCE USE DISORDERS:

Drug: It is derived from a French word 'drogue'. A medical substance used in the treatment of disease. (Taber's  Dictionary). 

'Drug dependencelsubstance  dependence: A state psychic, sometimes also physical, resulting from taking a drug characterized by behavioural and other responses that always include a compulsion to take a drug on a continuous or periodic basis in order to experience  its psychic effects and sometimes to avoid the discomfort of its absence. Tolerance may or may not be present. 

Physical dependence: Physical dependence occurs when  the drug user's  body becomes so accustomed to a particular drug that slhe  can fundtion normally only if the drug is present  in  the body chemistry. 

Psychic Dependence:  Psychic or psychological  dependence occurs when the drug is central to a person's thought, emotions and activities. It is difficult for the person to stop thinking of  the drug which causes intense craving for it and its effect.  . 

Tolerance: It is 'an  adaptive state characterized by a diminished  response to the same quantity of a drug or by the fact that a larger dose is required to produce the same degree of pharmacodynamic effect'. (WHO Bulletin, 1965) 

Withdrawal:  It is an organic mental disorder following  cessation (stopping)  or reduction in the intake of a substance such as alcohol, an opioid, amphetamines, tobacco or sedatives that have previously been used regularly to induce intoxication.  


Related Discussions:- Psychoactive substance use disorders

Explain significance of mitosis for embryonic development, Q. What is the s...

Q. What is the significance of mitosis for the embryonic development? Every embryo grows from a single cell that bears mitosis and generates other cells that also divide themse

What is probing depth, What is Probing depth Probing depths can be infl...

What is Probing depth Probing depths can be influenced by the tissue type- shallow depths are associated with a keratinized collar, whereas deeper depths are associated with mo

Pre and post-operative nursing care of a child, Pre-operative and Post-oper...

Pre-operative and Post-operative Nursing Care of a Child with Cleft Lip: We shall begin with pre-operative nursing care and then focus on post-operative care. As you know that

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What do you meant by medical writing, Question 1 : What do you meant by ...

Question 1 : What do you meant by medical writing? Show various types of medical writing. Define and explain briefly medical writing Discuss various types of medical w

Define the bacillus cereus, Define the Bacillus cereus Bacillus cereus ...

Define the Bacillus cereus Bacillus cereus is not a common cause of food poisoning. It is a Gram positive, aerobic, spore forming rod shaped bacteria normally present in soil,

Foods implicated in botulism, The types of foods involved in botulism vary ...

The types of foods involved in botulism vary according to food preservation and eating habits in different regions. Any food that is conducive to outgrowth and toxin production, th

What is schistosomiasis. explain in brief., What is Schistosomiasis? Explai...

What is Schistosomiasis? Explain in brief. A disease cause by the trematode parasite Schistosoma found around the world. Numerous species are responsible for diseases ranging f

Human physiology, which bones forms lhe non moving muscle attachment in

which bones forms lhe non moving muscle attachment in

Regulation of blood glucose level, REGULATION OF BLOOD GLUCOSE LEVEL Va...

REGULATION OF BLOOD GLUCOSE LEVEL Various levels of regulation are exerted at substrate level, hormonal level, enzymatic level and at organ level on carbohydrate  metabolism  s

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd