Protein percentage in lowry method, Biology

Assignment Help:

How to calculate protein percentage in Lowry method?

Ans) By verification of optical density by coloimetric method

 


Related Discussions:- Protein percentage in lowry method

fat digestion requires two steps, Fat digestion requires two steps? What a...

Fat digestion requires two steps? What are the steps and what enzymes are used to accomplish each step?

Determine the objectives of economic evaluation, Determine the Objectives o...

Determine the Objectives of Economic Evaluation? There are two objectives of economic evaluation. These are: 1) To introduce resource consideration into analysis and to asse

Illustrate homologous chromosomes, Q. In which period of meiosis does the p...

Q. In which period of meiosis does the pairing of homologous chromosomes occur? The pairing of homologous chromosomes is a very important step for meiosis because the rightness

Nucleic acid amplification, Ask Prepare a 2-4 page summary of nucleic aci...

Ask Prepare a 2-4 page summary of nucleic acid amplification techniques that are being explored in the development of nucleic assays for clinical use. Research and identify a mo

Explain pullulan, Pullulan Pullulan is a water soluble edible microbial...

Pullulan Pullulan is a water soluble edible microbial polysaccharide consisting of Maltotriose units (α 1 → 6), as shown in  the figure 2.12. It is produced by yeast  Aureobasi

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Anaplasia - characteristics define cancer, Anaplasia - Characteristics Defi...

Anaplasia - Characteristics Define Cancer Anaplasia is a structural abnormality where cells resemble primitive or embryonic tissue in which adult functions are diminished or t

Define unsafe water and sanitation - public nutrition, Define Unsafe Water ...

Define Unsafe Water and sanitation - public nutrition? Safe water and sanitation may seem tenuous in their link to food security but their impact is unquestionable. With 19% US

What is the difference between smallpox and measles, Q. What is the differe...

Q. What is the difference between smallpox (variola) and measles? The Smallpox is a viral infection like measles. The Smallpox is transmitted by respiratory secretions, saliva

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd