Protein percentage in lowry method, Biology

Assignment Help:

How to calculate protein percentage in Lowry method?

Ans) By verification of optical density by coloimetric method

 


Related Discussions:- Protein percentage in lowry method

What do you mean by canning, Q. What do you mean by Canning? Canning T...

Q. What do you mean by Canning? Canning The term canning is generally applied to foods, more specifically, to the foods preserved by heat processing. It aimgto destroy microo

The effect of light on the growth of stems, The effect of light on the grow...

The effect of light on the growth of stems (a)  Plant some seeds that grow rapidly like as oats, radish, bean or mustard seeds in two flower pots. When the seedlings are about

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain about urinary system, Explain about Urinary system Urinary sys...

Explain about Urinary system Urinary system provides us with the service of disposing the waste products carried by blood. This function is also known as excretion.

Define assessment of manganese status, Define Assessment of Manganese Statu...

Define Assessment of Manganese Status? The body Mn status has not been yet established by laboratory tests. Though the normal range of serum Mn concentration is found out to b

Nutrition in organisms, a project on different types of heterotrophic mode ...

a project on different types of heterotrophic mode of nutrition in organisms

Which hormones stimulate glycogenolysis, Which hormones stimulate glycogeno...

Which hormones stimulate glycogenolysis? Glucagon  in liver and epinephrine  in liver  and muscle stimulate glycogenolysis.

Explain microspores mother cell in angiosperms, Explain in sequence the eve...

Explain in sequence the events that lead to the development of a 3-celled pollen grain from microspores mother cell in angiosperms.

Which of mendel''s postulates demonstrated in crosses, Which of Mendel's po...

Which of Mendel's postulates can only be demonstrated in crosses involving at least two pairs of traits? a) Segregation b) dominance/recessiveness c) independent assortment d) unit

Individual neurons communicate, A human is better able to ride a bike becau...

A human is better able to ride a bike because individual neurons communicate information faster than modern computer chips. true or false

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd