Prevention - rheumatic fever, Biology

Assignment Help:

Acute GAS pharyngitis should be treated promptly by penicillin or other antibiotics. Indian Council of Medical Research (ICMR) recommends that all cases of pharyngitis must receive penicillin. One need not wait to isolate GAS organisms. A single dose of 1.2 mega units of Benzathine penicillin given IM or a ten day course of oral penicillin V is given. In case of allergy to penicillin, one uses macrolides or cephalosporins.

                                                                         Table Prophylaxis of Rheumatic Fever

                        Primary Prophylaxis
                         Intramuscular                                      Benzathine penicillin G  12,00,000 U once(6,00,000 U, if weight less than 27 kgs)
                         Oral                                                     Penicillin V                      500 mg bid daily for 10 days
                                                                                    Erythromycin                   250 mg bid daily for 10 days
                                                                                    Other (Clindamycin,  Dose varies    
                         Nafcillin, Ampicillin,        
                         Amoxicillin,        
                         Cephalexin)

                    Secondary Prophylaxis

                     Intramuscular                                         Benzathine penicillin G  12,00,000 U every 3-4 weeks
                      Oral                                                        Penicillin V                     250 mg bid daily
                                                                                     Sulfadiazine                  1 gm od (0.5 gm od in children)
                                                                                     Erythromycin                 250 mg bid daily  
                     stearate


Related Discussions:- Prevention - rheumatic fever

Define composition of the diet during pregnancy period, Define composition ...

Define composition of the diet during pregnancy period? The composition of the diet during pregnancy should be the same as for a non- pregnant woman; hence the contribution to

Find the genotypes and phenotypes of the f1, Determine the genotypes and ph...

Determine the genotypes and phenotypes of the F1 generation from a colour blind father and a mother who is homozygous for normal colour vision.

Precautions to prevent from hiv , Precautions to prevent from HIV  To a...

Precautions to prevent from HIV  To avoid HIV infection one should practice safe sex (use of condoms). Besides a few simple precautions are given for protection against HIV inf

Common disease of sheep, COMMON DISEASE OF SHEEP - 1 .       ANTHRAX ...

COMMON DISEASE OF SHEEP - 1 .       ANTHRAX - Persons working in wool factories may get infection by breathing. 2 .       BLACK QURTER 3 .       HAEMORRHAGIC S

What is the expected phenotypic proportion, In tomatoes, two alleles of one...

In tomatoes, two alleles of one locus determine the character difference of purple versus green stems (alleles are P and p with P being completely dominatn and coding for purple st

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Points, What is the classification of protozoa with examples

What is the classification of protozoa with examples

Tertiary prevention- preventive strategies for food allergy, Define Tertiar...

Define Tertiary Prevention- preventive strategies for food allergy? Tertiary Prevention: Targets the control of factors that cause symptoms. This strategy would be appropriate

Of which substance are microtubules made, Of which substance are microtubul...

Of which substance are microtubules made? In which structures and cellular processes do microtubules participate? Microtubules are made of consecutive dimers of the protein tub

Explain about the cheese making - methods of food processing, Explain about...

Explain about the Cheese Making - methods of food processing? Cheese is a way of preserving milk for long periods of time. In this process, the milk in cheese becomes something

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd