Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Acute GAS pharyngitis should be treated promptly by penicillin or other antibiotics. Indian Council of Medical Research (ICMR) recommends that all cases of pharyngitis must receive penicillin. One need not wait to isolate GAS organisms. A single dose of 1.2 mega units of Benzathine penicillin given IM or a ten day course of oral penicillin V is given. In case of allergy to penicillin, one uses macrolides or cephalosporins.
Table Prophylaxis of Rheumatic Fever
Primary Prophylaxis Intramuscular Benzathine penicillin G 12,00,000 U once(6,00,000 U, if weight less than 27 kgs) Oral Penicillin V 500 mg bid daily for 10 days Erythromycin 250 mg bid daily for 10 days Other (Clindamycin, Dose varies Nafcillin, Ampicillin, Amoxicillin, Cephalexin)
Secondary Prophylaxis
Intramuscular Benzathine penicillin G 12,00,000 U every 3-4 weeks Oral Penicillin V 250 mg bid daily Sulfadiazine 1 gm od (0.5 gm od in children) Erythromycin 250 mg bid daily stearate
Define composition of the diet during pregnancy period? The composition of the diet during pregnancy should be the same as for a non- pregnant woman; hence the contribution to
Determine the genotypes and phenotypes of the F1 generation from a colour blind father and a mother who is homozygous for normal colour vision.
Precautions to prevent from HIV To avoid HIV infection one should practice safe sex (use of condoms). Besides a few simple precautions are given for protection against HIV inf
COMMON DISEASE OF SHEEP - 1 . ANTHRAX - Persons working in wool factories may get infection by breathing. 2 . BLACK QURTER 3 . HAEMORRHAGIC S
In tomatoes, two alleles of one locus determine the character difference of purple versus green stems (alleles are P and p with P being completely dominatn and coding for purple st
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
What is the classification of protozoa with examples
Define Tertiary Prevention- preventive strategies for food allergy? Tertiary Prevention: Targets the control of factors that cause symptoms. This strategy would be appropriate
Of which substance are microtubules made? In which structures and cellular processes do microtubules participate? Microtubules are made of consecutive dimers of the protein tub
Explain about the Cheese Making - methods of food processing? Cheese is a way of preserving milk for long periods of time. In this process, the milk in cheese becomes something
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd