plant growth and development, Biology

Assignment Help:
what is meant by morphogenesis in roots and shoot

Related Discussions:- plant growth and development

Composition-atmosphere, Composition The present day composition of atmo...

Composition The present day composition of atmosphere is the product of a lengthy evolutionary process that began more than four billion years ago. It is composed of a mixture

Origin, What group did reproduction via sexual exchange of genetic informat...

What group did reproduction via sexual exchange of genetic information originate in?

What phenotypic ratio you expect from such a cross, Assume that a dihybrid ...

Assume that a dihybrid cross (AaBb X AaBb) is made in which the gene loci are autosomal, independently assorting, and incompletely dominant. What phenotypic ratio would you expect

Morphological differences between monocot and dicot plants, Q. What are the...

Q. What are the major morphological differences between monocot plants and dicot plants? The main separation criteria between monocots and dicots are: number of cotyledons (see

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain adverse effects of ritonavir, Explain Adverse effects of ritonavir ...

Explain Adverse effects of ritonavir - Adverse reactions are common to full doses of ritonavir, but less common with the low doses used in PI combinations. Ritonavir can cause

Treatment of diarrhea, Treatment of diarrhea Loperamide (Imodium, and o...

Treatment of diarrhea Loperamide (Imodium, and others), an over-the-counter synthetic opioid (4-mg loading dose, then 2 mg orally after each loose stool to a maximum of 16 mg/d

Objective of the law of contract, The law of contract is that the branch of...

The law of contract is that the branch of law which determines the circumstances in which promises made by the parities to a contract shall be legally binding on them. Its rules de

How dna-rna hybridization occurs, Q. How DNA-RNA hybridization occurs B...

Q. How DNA-RNA hybridization occurs Both DNA and RNA are able to form hybrids in solution with other RNA or DNA molecules which have complementary base pairing. Double-stranded

Can you explain vestibular system, Q. What is the vestibular system? How do...

Q. What is the vestibular system? How does it operate? The vestibular system is the part of the ear that participates in the regulation and control of the equilibrium of the bo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd