Photosynthesis carbon dioxide, Biology

Assignment Help:

Q. Why is it said that during photosynthesis carbon dioxide is improved to form glucose?

During photosynthesis carbon dioxide is energetically improve with hydrogen from water. Water broken by photolysis is the hydrogen main donor of the reaction. Glucose is made of oxygen and carbon atoms obtained from carbon dioxide and of hydrogen atoms obtained from water.


Related Discussions:- Photosynthesis carbon dioxide

Describe how the international astronomical union defines, Describe how the...

Describe how the International Astronomical Union defines a planet. Also include why Pluto is no longer considered a planet.

Explain identification of cancer cells from normal cells, Explain Identific...

Explain Identification of Cancer Cells from Normal Cells? Cancer cells can be distinguished from normal cells by examining them under a microscope. In a specific tissue cancer

What is pcr and how does pcr works, What is PCR? How does PCR works? Th...

What is PCR? How does PCR works? The PCR, polymerase chain reaction, is a method to synthesize many copies of specific regions of a DNA molecule known as target-regions. Its in

What are the factors that for influencing photosynthesis, What are the fact...

What are the factors that for influencing photosynthesis also interfere with the gross primary productivity? Mostly water and light, but also mineral salts, temperature and car

Hirschsprungs disease, Hirschsprungs Disease (Congenital Megacolon): T...

Hirschsprungs Disease (Congenital Megacolon): This  is also known as congenital megacolon. There is absence of ganglion cells, submucus plexus  and intramural plexus  (parasym

Explain protein stabilized food emulsions, Protein Stabilized Food Emulsion...

Protein Stabilized Food Emulsions Many food products are emulsions (eg. milk cream, ice creams, cream, butter etc.) and protein constituents often play a major role in the stab

Explain the combating drug-resistant diseases, Explain the Combating drug-r...

Explain the Combating drug-resistant diseases? The growth of drug-resistant strains of disease-causing bacteria threatens the current effectiveness of cheap antibiotics. This i

Riccia, What isthe Riccia

What isthe Riccia

Psychosocial therapy, PSYCHOSOCIAL THERAPY: Psychosocial therapy is on...

PSYCHOSOCIAL THERAPY: Psychosocial therapy is one of  the important treatment modaIities used for the patients with mental disorders. It is given along with other therapies or

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd