Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Why is it said that during photosynthesis carbon dioxide is improved to form glucose?
During photosynthesis carbon dioxide is energetically improve with hydrogen from water. Water broken by photolysis is the hydrogen main donor of the reaction. Glucose is made of oxygen and carbon atoms obtained from carbon dioxide and of hydrogen atoms obtained from water.
Describe how the International Astronomical Union defines a planet. Also include why Pluto is no longer considered a planet.
Explain Identification of Cancer Cells from Normal Cells? Cancer cells can be distinguished from normal cells by examining them under a microscope. In a specific tissue cancer
What is PCR? How does PCR works? The PCR, polymerase chain reaction, is a method to synthesize many copies of specific regions of a DNA molecule known as target-regions. Its in
What are the factors that for influencing photosynthesis also interfere with the gross primary productivity? Mostly water and light, but also mineral salts, temperature and car
Hirschsprungs Disease (Congenital Megacolon): This is also known as congenital megacolon. There is absence of ganglion cells, submucus plexus and intramural plexus (parasym
Protein Stabilized Food Emulsions Many food products are emulsions (eg. milk cream, ice creams, cream, butter etc.) and protein constituents often play a major role in the stab
Explain the Combating drug-resistant diseases? The growth of drug-resistant strains of disease-causing bacteria threatens the current effectiveness of cheap antibiotics. This i
What isthe Riccia
PSYCHOSOCIAL THERAPY: Psychosocial therapy is one of the important treatment modaIities used for the patients with mental disorders. It is given along with other therapies or
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd