Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Why is it said that during photosynthesis carbon dioxide is improved to form glucose?
During photosynthesis carbon dioxide is energetically improve with hydrogen from water. Water broken by photolysis is the hydrogen main donor of the reaction. Glucose is made of oxygen and carbon atoms obtained from carbon dioxide and of hydrogen atoms obtained from water.
HARD Y - WEINBERG LAW - Proposed by G.H. Hardy and W. Weinberg in 1908 independently. The law states "the frequency of genes or alleles in a population remains constant
Cry o Preserved Allografts (Homograft) : As these are not mounted, a free hand suturing in two layers has to be done. The valve is thawed by protocol. The septal muscle i
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain about the Niacin (nicotinic acid) deficiency? Niacin (nicotinic acid) deficiency classically results in pellagva, which is a chronic wasting disease associated with a c
Q. Which are the subproducts of the photochemical phase that are essential for the chemical stage of photosynthesis? The chemical stage of photosynthesis depends on ATP and NAD
Explain about the Shade Drying? Shade drying is carried out for products which can lose their colour and/or turn brown if put in direct sunlight. Products that have naturally v
Explain Adverse effects of ritonavir - Adverse reactions are common to full doses of ritonavir, but less common with the low doses used in PI combinations. Ritonavir can cause
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd