Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Pathophysiology of constrictive pericarditis?
Ans.
The thickened and rigid pericardium causes constriction of the heart and restricts ventricular dialatation and diastolic filling of the ventricles. The thickened rigid pericardium can cause dissociation of intracardiac and intrathoracic pressures and elevation of diastolic intracardiac pressures. This results in systemic and pulmonary venous congestion. Since the early phase of ventricular relaxation is normal, the early filling of the ventricles take place normally. Further relaxation of ventricles are restricted by the thickened pericardium resulting in acute elevation of diastolic ventricular pressure which gives a square root (") appearance to the diastolic ventricular pressure tracing. Uniform constriction of all the four cardiac chambers results in equalization of diastolic pressures in all the four chambers. This is different from restrictive cardiomyopathy where the difference in diastolic pressure between ventricles will be more than 5 mm. of Hg. The myocardium is usually normal in structure and function. This results in good systolic function.
The ventricular filling takes place during early filling phase only as further filling is prevented by the thickened and rigid pericardium.
Your task is to describe genetic algorithms, explain why genetic algorithms are useful in solving the problem you have been set and conduct an investigation into the optimum parame
1000 words
Define Nutrition Screening Initiative (NSI)? (NSI) tries to identify basic risk factors - inappropriate food intake, poverty, social isolation, disability, acute / chronic dise
Why isn't the cooking of vitamin C-containing foods appropriate for vitamin C supply? To obtain vitamin C, for example, from an orange dessert, the vitamin-containing food cann
most recent classification of parasitic protozoa with its general characters
Starr-Edward (S-E) Silastic Ball Valve Prosthesis : This was introduced in 1961 by Albert Stm and has different models for mitral and aortic positions. It is a cage and b
why cerebellum more developed in mammals that jump or fly?
Valve Thrombosis : Valve thrombosis causes sudden deterioration of the patient's haemodyarnics. A stuck valve may produce both stenosis and incompetence. If diagnosed early s
Types of Blood Vessel Arteries Arteries carry blood away form the heart via the pulmonary artery and aorta. Arterioles As major arteries begin to branch , th
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd