Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Optional use values of biodiversity?
Optional values are associated with potential use in the future. Accordingly one opts to conserve biodiversity based on the hope that it could be used directly or indirectly in the future, perhaps as a source of genetic material, for pharmaceuticals, crop enhancement, etc. There are many indications that some societies or people are willing to pay an additional sum, over and above what a future use value of a biological resource in worth, in order to guarantee the future access to the resource. For example, when species go extinct their potential is never discovered and we may have lost that very thing that is essential to save millions of lives, enhance food production or provide the ability to resist future diseases and pest attacks. But once lost, these resources will remain unknown and undiscovered forever.
This consideration necessitates leaving our options open to have access to certain gene pools that may be of use in the future, especially in the face of climate change, as maximum genetic diversity promoted maximum flexibility of species and ecosystems to respond to changes in climate.
Q. What are the four major groups into which the study of the plants is divided? In Botany the plant kingdom is divided into pteridophytes, bryophytes, angiosperms and gymnospe
Q. What is biotic potential? The Biotic potential is the capability of growth of a given population under hypothetical optimum conditions, i.e., in an environment without limit
Pocket Psedocyst : lesions present as endodontic origins from canals . It makes lumens resemble granuloma . All lesions lined until root canal or apical foramen communicat
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Various integral proteins have multiple membrane-spanning -helices. Bacteriorhodopsin, a protein found in a photosynthetic bacterium captures the energy from light and uses it to
B u f fa l o- p o x The disease is caused by an orthopox virus, closely related to the vaccinia virus. It is not clear whether it should be considered
What is the optimum temperature for catalyses? For any chemical reaction, the reaction rate enhances with temperature, so the higher the temperature, the faster the rate. For a
Define National Iodine Deficiency Disorder Control Programme (NIDDCP)? The prevalence of iodine deficiency disorders (IDD) are seen more among adolescent's young adults and sc
You have two enzymes, 1 and 2. Both convert substance A into substance B. 1 is inhibited by B, because B partially blocks the active site and will not allow more A to enter. 2 is i
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd