Optional use values of biodiversity, Biology

Assignment Help:

Q. Optional use values of biodiversity?

Optional values are associated with potential use in the future. Accordingly one opts to conserve biodiversity based on the hope that it could be used directly or indirectly in the future, perhaps as a source of genetic material, for pharmaceuticals, crop enhancement, etc. There are many indications that some societies or people are willing to pay an additional sum, over and above what a future use value of a biological resource in worth, in order to guarantee the future access to the resource. For example, when species go extinct their potential is never discovered and we may have lost that very thing that is essential to save millions of lives, enhance food production or provide the ability to resist future diseases and pest attacks. But once lost, these resources will remain unknown and undiscovered forever.

This consideration necessitates leaving our options open to have access to certain gene pools that may be of use in the future, especially in the face of climate change, as maximum genetic diversity promoted maximum flexibility of species and ecosystems to respond to changes in climate.


Related Discussions:- Optional use values of biodiversity

Major groups into which the study of the plants is divided, Q. What are the...

Q. What are the four major groups into which the study of the plants is divided? In Botany the plant kingdom is divided into pteridophytes, bryophytes, angiosperms and gymnospe

What is biotic potential, Q. What is biotic potential? The Biotic poten...

Q. What is biotic potential? The Biotic potential is the capability of growth of a given population under hypothetical optimum conditions, i.e., in an environment without limit

Pocket psedocyst-endodontics principles and practice, Pocket Psedocyst : le...

Pocket Psedocyst : lesions present as endodontic origins from canals . It makes lumens resemble granuloma . All lesions lined until root canal or apical foramen communicat

Glomerular filtrate, Normal 0 false false false EN-IN ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Multiple membrane-spanning proteins, Various integral proteins have multipl...

Various integral proteins have multiple membrane-spanning   -helices. Bacteriorhodopsin, a protein found in a photosynthetic bacterium captures the energy from light and uses it to

Buffalo-pox, B u f fa l o- p o x The disease i...

B u f fa l o- p o x The disease is caused by an orthopox virus, closely related to the vaccinia virus. It is not clear whether it should be considered

What is the optimum temperature for catalyses, What is the optimum temperat...

What is the optimum temperature for catalyses? For any chemical reaction, the reaction rate enhances with temperature, so the higher the temperature, the faster the rate. For a

Define national iodine deficiency disorder control programme, Define Nation...

Define National Iodine Deficiency Disorder Control Programme (NIDDCP)? The prevalence of iodine deficiency disorders (IDD) are seen more among adolescent's young adults and sc

Advantage of using the regulatory strategy of enzyme, You have two enzymes,...

You have two enzymes, 1 and 2. Both convert substance A into substance B. 1 is inhibited by B, because B partially blocks the active site and will not allow more A to enter. 2 is i

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd