Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Nurse's Role During Phototherapy
You should take care of following while nursing the baby in receiving phototherapy.
Check the lights of phototherapy unit before use and place it in a proper place.
Eye Care: Because of the potential for eye damage, the eyes should be covered while phototherapy is in use. Cover the eyes with pads without placing excessive pressure on the eyes and be carefully positioned to avoid occluding the nares. To permit evaluation of the infant's eyes, eye patches should be removed every-4 hours and changed every 8 hours. The patches should be removed during feedings and parental visits.
Temperature: You should monitor infant's temperature frequently.
Fluid balance: Fluid balance must be carefully monitored. Daily weight and close monitoring of intake and output such as urine volume and specific gravity may indicate a need for increased fluids as much as 30 per cent i.e. 10-30 ml/kg/ day either orally or intravenously.
Parental Explanations: The treatment of phototherapy can be very disturbing to parents. Parents often feel guilty that perhaps something they did or failed to do resulted in their infant's jaundice. Reassurance and support are vital especially for the lactating mother who may question her ability to adequately feed her infant. Eye patches tend tn be especially. The lights should be turned off and eye patches removed during visits so that normal parent-infant interaction can occur.
Classification of Minerals Minerals can be separated into two main categories, namely, main elements (calcium, potassium, phosphorous, chlorine, sodium, magnesium) and trace el
Antimicrobial Prophylaxis - Controversial The need for prophylaxis in breast surgery, herniorraphy and other "clean" surgical procedures has been controversial. Medical Letter
What is morphological nature of angiosperm
Q. What are the main phases and clinical manifestations of schistosomiasis? The Schistosomiasis has acute and chronic phases and Days after the infection the cercarial dermatit
Explain the Mortality and Survivorship Curves? Mortality : Just as a population has a birth rate, so does it have a death rate. A populations rate of death, or the number of
Explain about the Hypokalemia? Normal serum K ranges from 3.5-5 mM/L. Hypokalemia or low plasma K levels can occur with a net shift of K from the plasma to the cells. This shi
Q. What is ancylostomiasis? The Ancylostomiasis is a disease caused by the Necator americanus or Ancylostoma duodenale both hookworms belonging to the nematode phylum (roundwor
After glaciers, ice caps and snowfields, ground water is the next largest fresh water reservoir. Precipitation that does not evaporate back into the air and does not run off over t
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd