Need for microbiological analysis of environment sample, Biology

Assignment Help:

Explain Need For Microbiological Analysis of Environment Samples?

Once the food is harvested, it passes through various operating steps before reaching the consumer. These steps include -  

  • Harvesting and transportation to the food processing facilities,
  • Separation of desirable part of the food from raw material like removing of skin from the food or potatoes, etc.
  • Cleaning of food items themselves and also of equipment and surfaces, and
  • Processing and packaging of food items.

 

Contamination of food items can take place during these steps depending upon the hygienic and sanitary practices applied. Processing environment has an important contributory role in the addition of food microbiota. Heavily contaminated processing environment generally results in the poor quality food products and also pose a threat with food borne pathogens. To avoid these problems, therefore, it is essential to sample the processing environment, i.e., floors, drains, equipments and utensils, contact surfaces, air, storage sites, personnel hands and clothing etc. for microbial quality. Analysis of environment samples allows investigators to evaluate secondary contamination sources in the processing environment. Results of analysis also helps the processor to know the efficacy of cleaning and sanitization procedure, to trace the source of microbes in the processing facility and also to define the critical control points in the food processing operation. This may also helps in establishing the efficient HACCP (Hazard Analysis Critical Control Point) Plan.


Related Discussions:- Need for microbiological analysis of environment sample

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Genetics, what about cytoplasmic sex determination

what about cytoplasmic sex determination

Kingdoms, The organisms that live in hostile environments that cannot suppo...

The organisms that live in hostile environments that cannot support other forms of life are members of what kingdom?

Procedure of radiographic template, Procedure of radiographic template ...

Procedure of radiographic template It is very similar to a flasking procedure. Mix slow setting irreversible hydrocolloid (alginate) with cold water (to gain more working ti

Explain benefits of protein, Explain benefits of Protein Protein: Once ...

Explain benefits of Protein Protein: Once the energy requirements have  been estimated, protein requirements can be addressed. The aim is to achieve nitrogen balance. There are

Glucose rehydration therapy, The movement  of Na + and glucose  from the l...

The movement  of Na + and glucose  from the lumen  of the intestine  across  the epithelial  cell to the blood  sets up a dissimilarity  in osmotic  pressure  across  the cell. As

Photosynthesis, photosynthesis moderates global warming, briefly explain th...

photosynthesis moderates global warming, briefly explain this statement

What is diabetes mellitus, Question 1 What is diabetes mellitus? Discuss b...

Question 1 What is diabetes mellitus? Discuss briefly its pathogenesis. Explain how would you diagnose this disorder Question 2 Discuss the following Glucose tolerance

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd