Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Need For Microbiological Analysis of Environment Samples?
Once the food is harvested, it passes through various operating steps before reaching the consumer. These steps include -
Contamination of food items can take place during these steps depending upon the hygienic and sanitary practices applied. Processing environment has an important contributory role in the addition of food microbiota. Heavily contaminated processing environment generally results in the poor quality food products and also pose a threat with food borne pathogens. To avoid these problems, therefore, it is essential to sample the processing environment, i.e., floors, drains, equipments and utensils, contact surfaces, air, storage sites, personnel hands and clothing etc. for microbial quality. Analysis of environment samples allows investigators to evaluate secondary contamination sources in the processing environment. Results of analysis also helps the processor to know the efficacy of cleaning and sanitization procedure, to trace the source of microbes in the processing facility and also to define the critical control points in the food processing operation. This may also helps in establishing the efficient HACCP (Hazard Analysis Critical Control Point) Plan.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
root plants
what about cytoplasmic sex determination
The organisms that live in hostile environments that cannot support other forms of life are members of what kingdom?
Procedure of radiographic template It is very similar to a flasking procedure. Mix slow setting irreversible hydrocolloid (alginate) with cold water (to gain more working ti
What is general characteristics of invertebrates
Explain benefits of Protein Protein: Once the energy requirements have been estimated, protein requirements can be addressed. The aim is to achieve nitrogen balance. There are
The movement of Na + and glucose from the lumen of the intestine across the epithelial cell to the blood sets up a dissimilarity in osmotic pressure across the cell. As
photosynthesis moderates global warming, briefly explain this statement
Question 1 What is diabetes mellitus? Discuss briefly its pathogenesis. Explain how would you diagnose this disorder Question 2 Discuss the following Glucose tolerance
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd