Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Messenger RNA (mRNA) are the proteins are not synthesized directly from the genomic DNA. Insteadof that an RNA template (a precursor mRNA) is constructed from the sequence of gene. This RNA is then processed in number of ways, including splicing. Spliced single-stranded RNAs destined to become the templates for protein synthesis are called as mRNAs, The term mRNA is used only for the mature transcript with polyA tail and with all introns removed, rather than the primary transcript in nucleus. As such, an mRNA will have a 5' untranslated area, a coding area, a 3' untranslated area and (almost always) a poly(A) tail. Typically about 2% of total cellular RNA is mRNA.
Q. Where are the adrenal glands located? How many are they and what are their portions? Each adrenal gland is located on the top of each kidney (forming a hat-like structure fo
How does true motility differ from brownian movement? What morphological structre is responsible for bacteria motility? Why is the wet preparation discarded in disinfectant s
Determine the stage 1 implant surgery Following stage 1 surgery, prior to commencing on the prosthetic procedures in the conventional loading protocol it is critical that the s
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Wetlands - Lentic Ecosystems Wetlands are permanently or periodically water covered areas. They can be defined as submerged or saturated lands either artificially or naturall
What is Atrial Septal Defect ? Figure: Anatomical location of Am Indication for Surgery : The presence of an ASD or PAPVC (Partial Anomalous Pulmonary Venous Conn
MOUT H - It is as transverse slit. It is pseudo type i.e. not open directly into alimentary canal. Mouth is covered by upper & lower movable lips. Movement is due to arb
Q. What is the relationship between the ovulation and menstrual cycle? Ovulation is the releasing of the female gamete from the ovary and Ovulation is a periodical event that o
The initial evaluation of new onset heart failure should include an electrocardiogram, chest radiograph, and B-type natriuretic peptide assay. The cardiac rhythm may be normal sinu
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd