Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Magnetic resonance imaging (MRI):
It is in use as a clinical diagnostic tool since 1980. The distribution of hydrogen nuclei (protons), present in cellular water, depends on the tissue type and whether or not the tissue is healthy or diseased. The MRI machine produces images by creating resonance (vibrations) in the water found in the body. The MRI uses radio waves and strong magnetic fields to create images. The radio signals emitted from the water in the body are captured by receptors, called a coil. The coil produces a cross sectional image of body water content found in the tissues. This tool can differentiate very minute differences in water density in the cellular or tissue level.
An osteoclast is a type of bone cell that absorbs bone tissue by removing its mineralized matrix and breaking up the organic bone. This process is known as bone resorption
THEO R Y OF PANGENESIS - Proposed by Charles Darwin. According this miniature present in the every body cell i.e. called gemmule
Explain about the Glycemic Index (GI)? In the previous sections, we have studied that some carbohydrates are rapidly digested and absorbed, some are digested slowly while some
what is the biological significance of skeleton
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
I need a list of equipment necessary to complete it as well as a method to isolate the cell parts, how much protein is in the red blood cell as well as the amount of DNA in the cel
Why is it important for core body temperature to stay more constant than skin temperature?
Explain Protein Deficiencies in Nutritional Care? A depleted amino acid pool leads to poor wound healing (dehiscence), delayed healing of fractures, anaemia, depressed pulmonar
Q. Ecological Evidence of organisms to environment? Ecology is concerned with organisms in relationships to their environment. These relationships may be classified as biotic,
Of which substance do elastic fibers of the connective tissue are made? What are some functions of these fibers? The elastic fibers are made of a protein called elastin. Ela
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd