Implant exposure - implant surgery, Biology

Assignment Help:

Describe Implant exposure?

Sound surgical principles to minimize the surgical exposure based on the access required should be employed. A series of surgical approaches to achieve this are described below.

When adequate tissue is present, the purpose of this phase is to remove tissue for the insertion of the abutment and a transitional restoration. However, the excision of this tissue with a circular punch, for example, may not achieve the ideal position for the gingival margin. It is for this reason that the minimal incision (H - shaped) was devised. This provides an opportunity to assess the contours and manipulate the tissues, if necessary, or to excise them, if more appropriate.


Related Discussions:- Implant exposure - implant surgery

Explain metabolic response to injury, Explain Metabolic Response to Injury?...

Explain Metabolic Response to Injury? There is an increase in the basal metabolic rate above the normal. The degree of hyper metabolism is related to the severity of the injury

INVERTEBRATES - STRUCTURE & FUNCTION, 2. Describe the respiratory organs a...

2. Describe the respiratory organs and mechanism of respiration in pila.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain carrageenan, Carrageenan Carrageenan is a collective term for p...

Carrageenan Carrageenan is a collective term for polysaccharides prepared by alkaline extraction (and modification) from red seaweed (Rhodophycae). Carrageenan is a sulfated ga

Surgery for coronary artery disease in suregery, SURGERY FOR CORONARY ARTER...

SURGERY FOR CORONARY ARTERY DISEASE : Stenotic coronary artery disease (CAD) is caused by the thickening and narrowing of the coronary arteries (Atherosclerosis). Initially it cau

Write short note on cholesterol, Cholesterol, from stereos (solid) and the...

Cholesterol, from stereos (solid) and the Greek chole- (bile) followed by the chemical suffix -ol for an alcohol is an organic chemical substance classified as a waxy steroid of fa

Causes of cancer, Causes of Cancer We know earlier that a malignant tu...

Causes of Cancer We know earlier that a malignant tumor is a large aggregation of cancer cells, all of them descended from a single founder cell that was once a normal cell wi

Venipuncture - blood collection, Venipuncture : patient shoul...

Venipuncture : patient should be seated or supine for at least 20 minutes before sampling. An arm with an inserted intravenous line should be avoided. The median cubi

Show the efficient contraceptive method, Q. Why is the use of condoms not j...

Q. Why is the use of condoms not just a contraceptive method but also a health protection behavior? The use of condoms besides being an efficient contraceptive method also help

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd