Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
How you can Repair Ventricular Aneurysm with a patch?
Repair of Ventricular Aneurysm with a patch : Originally described by Cooley, as endoaneurysmorraphy, this has been largely replaced by endovenhicular circular patchplasty repair (Dor) or one of its modifications.
In this technique, dyskinesia or akinesia of anterior pat of ventricular septum are taken care of by sewing in a Dacron patch.
Integral steps of this operation are the same as previously described. After ventricular incision over the anterior part of the ventricular aneulysrn, by palpation, demarcation of normal muscle from the thinned out aneurysm is made out. A purse string suture of 2'0' poly propylene is passed all around and tightened so as to get the ideal vertical and transverse dimensions of the remaining left ventricle. The resulting defect, which is now circular or oval, is repaired using a collagen or gelatin impregnated polyester (Dacron) graft. The inner surface of this graft could be lined with autologus pericardium. In the modified Dor procedure adopted at Narayana Hridayalaya, purse string suture is not used but a correctly measured oval patch of similar graft is used to achieve the correct dimension and geometry of remaining LV. The overlying portion of aneurysm is closed in two layers using polypropylene sutures without pledgets.
Concepts and Definitions in Relation to Nutrient Requirements 1) The probability concept describes the relationship between the levels of intake and the probability of risk of
occurrence of e.coli 0157:H7 on vegetables
Phylum Placozoa The phylum Placozoa contains a single species of a minute marine animal Trichoplax adharens composed of a dorsal and ventral epithelial layer enclosing loose m
Importance of Forests - Fuel Wood The forests are renewable resources which provide us a wide variety of commodities. For man, forests have been a source of recreation and the
What are the major factors of colloidal dispersion The adsorption of ions by colloidal particles is a major factor in stabilizing a colloidal dispersion, since the colloidal pa
What is the indolacetic acid (IAA)? IAA or Indolacetic acid (indolyl-3-acetic acid) is the major natural auxin made by plants. It promotes plant growth and cellular differentia
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Meaning of Diabetes Self Management Education? You have learned that the treatment of diabetes depends upon the cooperation of the patient and also on how actively a patient
What are the main water properties that make water special for life? The water properties that make water biologically significant are molecular polarity, thermal stability (el
F u n g a l diseases A spergillosis Aspergillosis is mycotic disease of poultry and all other species of birds caused by a fungus known as Aspergillus fumigatus . F
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd