How much minerals should be taken for management of obesity, Biology

Assignment Help:

How much Minerals should be taken for management of obesity?

A diet high in sodium may promote retention of fluid in the body. Moderate restriction in the use of common/table salt may be helpful in a weight reducing diet, particularly if the patient is also hypertensive.


Related Discussions:- How much minerals should be taken for management of obesity

Taxonomy, what arachnid is beneficial

what arachnid is beneficial

Of which type of defense cell do viral infections, Of which type of defense...

Of which type of defense cell do viral infections stimulate the multiplication? The major leukocytes that generally multiply and participate in the defense against viral infect

What is polygenic inheritance?, What is polygenic inheritance? How does it ...

What is polygenic inheritance? How does it work?  The Polygenic inheritance, also called as quantitative inheritance, is the gene interaction in which a given trait is conditio

Transcribed regions, Transcribed regions The transcribed regions of the...

Transcribed regions The transcribed regions of the genes contain a number of regulatory elements that control exon splicing, mRNA transfer to cytoplasm translation, mRNA target

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What gases was the earths primitive atmosphere, Before the emergence of lif...

Before the emergence of life of what gases was the earth's primitive atmosphere constituted? The earth's primitive atmosphere was basically produced of methane, hydrogen, ammon

Texture of food product, Q. Texture of food product? Texture may be acc...

Q. Texture of food product? Texture may be accessed through touch or mouth feels. When the food is placed in the mouth, the surface of the tongue and other sensitive skin react

Explain kingdom plantae, Kingdom Plantae The kingdom plant are includes m...

Kingdom Plantae The kingdom plant are includes multicellular eukaryote organisation with photosynthetic nutrition. Typically cell has cellulose wall, sap vacuole, plastids and .

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd