Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
How does the hypophysis-corpus luteum negative feedback work? What is the name given to the atrophied corpus luteum after this feedback process?
After ovulation the estrogen and progesterone secretions from the corpus luteum inhibit the hypophyseal FSH and LH secretions (this happens by inhibition of GnRH, gonadotropin-releasing hormone, a hypothalamic hormone). The blood concentration of these adenohypophyseal hormones falls to basal levels again. As LH lowers the corpus luteum (luteum means "yellow") becomes atrophic and turns into the corpus albicans ("white"). With the regression of the corpus luteum the production of estrogen and progesterone ceases.
Explain the Cost Benefit Analysis? Cost-benefit analysis: Cost benefit analysis is a useful tool to establish the priority of a particular health service action. In this, both
Food Applications of Locust bean gum Locust bean gum has multiple applications in food industry. Let us focus on a few of the important ones: Locust bean gum has been u
What is Skeletal girdles? Explain in brief. In vertebrates, bones which connect the appendages on the left and right side of appendicular skeleton to each other. Skeletal girdl
Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4
Thermodynamics Thermodynamics tells us that every transformation of matter chemical transformation is accompanied with energy conversion .For example when complex molecul
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Given our knowledge so far we now need to evaluate if it is feasible to run the process in the designed vessel. We therefore need to compare the oxygen uptake rate and the oxygen t
What do you determine by Mantle? A thin sheetlike membranous extension of visceral mass of molluscs which forms two flaps of skin. Mantle secretes the shell on the dorsal side
Define the Drug and Drug Effect? In the discussions above, we reviewed the effect of food on drug metabolism. Interestingly, not only can drugs interact with food and alcohol,
A r se n i c Arsenic is a widely distributed environmental pollutant that gets released into the environment through industrial processes and agricultural usage. Arsenic c
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd