How does the hypophysis-corpus luteum negative feedback work, Biology

Assignment Help:

How does the hypophysis-corpus luteum negative feedback work? What is the name given to the atrophied corpus luteum after this feedback process?

After ovulation the estrogen and progesterone secretions from the corpus luteum inhibit the hypophyseal FSH and LH secretions (this happens by inhibition of GnRH, gonadotropin-releasing hormone, a hypothalamic hormone). The blood concentration of these adenohypophyseal hormones falls to basal levels again. As LH lowers the corpus luteum (luteum means "yellow") becomes atrophic and turns into the corpus albicans ("white"). With the regression of the corpus luteum the production of estrogen and progesterone ceases.

 


Related Discussions:- How does the hypophysis-corpus luteum negative feedback work

Explain the cost benefit analysis, Explain the Cost Benefit Analysis? C...

Explain the Cost Benefit Analysis? Cost-benefit analysis: Cost benefit analysis is a useful tool to establish the priority of a particular health service action. In this, both

Explain the food applications of locust bean gum, Food Applications of Locu...

Food Applications of Locust bean gum Locust bean gum has multiple applications in food industry.  Let us focus on a few of the important ones: Locust bean gum has been u

What is skeletal girdles? explain in brief., What is Skeletal girdles? Expl...

What is Skeletal girdles? Explain in brief. In vertebrates, bones which connect the appendages on the left and right side of appendicular skeleton to each other. Skeletal girdl

How do dioxins enter the human diet, Normal 0 false false f...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Thermodynamics, Thermodynamics Thermodynamics  tells us that every tran...

Thermodynamics Thermodynamics  tells us that every transformation of matter chemical  transformation is  accompanied with  energy conversion .For example  when complex  molecul

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Calculate the minimum dissolved oxygen tension, Given our knowledge so far ...

Given our knowledge so far we now need to evaluate if it is feasible to run the process in the designed vessel. We therefore need to compare the oxygen uptake rate and the oxygen t

What do you determine by mantle, What do you determine by Mantle? A thi...

What do you determine by Mantle? A thin sheetlike membranous extension of visceral mass of molluscs which forms two flaps of skin. Mantle secretes the shell on the dorsal side

Define the drug and drug effect, Define the Drug and Drug Effect? In th...

Define the Drug and Drug Effect? In the discussions above, we reviewed the effect of food on drug metabolism. Interestingly, not only can drugs interact with food and alcohol,

Arsenic, A r se n i c Arsenic is a widely distributed environmenta...

A r se n i c Arsenic is a widely distributed environmental pollutant that gets released into the environment through industrial processes and agricultural usage. Arsenic c

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd