How can the blood coagulation process be described, Biology

Assignment Help:

How can the blood coagulation (clotting) process be described?

Blood clotting encompasses a sequence of chemical reactions whose respective products are enzymes that catalyze the following reactions (that is why the clotting reactions are known as cascade reactions). In the plasma thromboplastinogen transforms into thromboplastin, a reaction triggered by tissue and platelet factors liberated after injury of the blood vessel. Thromboplastin then catalyzes along with calcium ions the transformation of prothrombin into thrombin.

Thrombin then catalyzes a reaction that makes fibrin from fibrinogen. Fibrin, as an insoluble substance, precipitates to produce a network that traps red blood cells and platelets forming the blood clot and having the hemorrhage.

 


Related Discussions:- How can the blood coagulation process be described

Explain phylogenetically proximal species, Q. Do the phylogenetically proxi...

Q. Do the phylogenetically proximal species have cells with proximal chromosome counts? The number of chromosomes typical of each species is proximal for phylogenetically proxi

How many cells are in the human body, How many cells are in the human body?...

How many cells are in the human body? According to "The Handy Science Answer Book" noted by the Science and Technology Department of the Carnegie Library of Pittsburgh (1994) th

Illustrate the effect of the drugs, Which of the following is an effect of ...

Which of the following is an effect of the following drugs? A. Drug A is an agonist of the Vasopressin2 Receptor (V2R).  High levels of Drug A in the extracellular spaces surro

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define protein requirement during thyphoid, Protein Protein: The requir...

Protein Protein: The requirement of protein is increased in typhoid, as  there  is  a massive tissue loss. Thus, the protein intake should be increased above the normal of  lg/

Proximity between amino and ribosomes acids, Q. Why is the proximity betwee...

Q. Why is the proximity between amino and ribosomes acids important for the protein formation? What is the enzyme that catalyzes that reaction? The proximity between amino and

Acid rain, what are the two main pollutants that contribute to acid rain

what are the two main pollutants that contribute to acid rain

Lysosomes, Lysosomes Lysosomes are small vesicles which are bounded ...

Lysosomes Lysosomes are small vesicles which are bounded by a single membrane & contain hydrolytic enzymes in the form of minute crystalline or semi crystalline granules of

Why vasa efferentia are the ductules, Vasa efferentia are the ductules lead...

Vasa efferentia are the ductules leading from: 1. Testicular lobules to rete testis 2. Rete testis to vas deferens 3. Vas deferens to epididymis 4. Epididymis to urethra

What are coacervates, What are coacervates? Coarcervates are small stru...

What are coacervates? Coarcervates are small structures made of the aggregation of organic molecules under water solution. By electrical attraction the molecules join into bigg

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd