Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
How can the blood coagulation (clotting) process be described?
Blood clotting encompasses a sequence of chemical reactions whose respective products are enzymes that catalyze the following reactions (that is why the clotting reactions are known as cascade reactions). In the plasma thromboplastinogen transforms into thromboplastin, a reaction triggered by tissue and platelet factors liberated after injury of the blood vessel. Thromboplastin then catalyzes along with calcium ions the transformation of prothrombin into thrombin.
Thrombin then catalyzes a reaction that makes fibrin from fibrinogen. Fibrin, as an insoluble substance, precipitates to produce a network that traps red blood cells and platelets forming the blood clot and having the hemorrhage.
Q. Do the phylogenetically proximal species have cells with proximal chromosome counts? The number of chromosomes typical of each species is proximal for phylogenetically proxi
How many cells are in the human body? According to "The Handy Science Answer Book" noted by the Science and Technology Department of the Carnegie Library of Pittsburgh (1994) th
Which of the following is an effect of the following drugs? A. Drug A is an agonist of the Vasopressin2 Receptor (V2R). High levels of Drug A in the extracellular spaces surro
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Protein Protein: The requirement of protein is increased in typhoid, as there is a massive tissue loss. Thus, the protein intake should be increased above the normal of lg/
Q. Why is the proximity between amino and ribosomes acids important for the protein formation? What is the enzyme that catalyzes that reaction? The proximity between amino and
what are the two main pollutants that contribute to acid rain
Lysosomes Lysosomes are small vesicles which are bounded by a single membrane & contain hydrolytic enzymes in the form of minute crystalline or semi crystalline granules of
Vasa efferentia are the ductules leading from: 1. Testicular lobules to rete testis 2. Rete testis to vas deferens 3. Vas deferens to epididymis 4. Epididymis to urethra
What are coacervates? Coarcervates are small structures made of the aggregation of organic molecules under water solution. By electrical attraction the molecules join into bigg
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd