How can the blood coagulation process be described, Biology

Assignment Help:

How can the blood coagulation (clotting) process be described?

Blood clotting encompasses a sequence of chemical reactions whose respective products are enzymes that catalyze the following reactions (that is why the clotting reactions are known as cascade reactions). In the plasma thromboplastinogen transforms into thromboplastin, a reaction triggered by tissue and platelet factors liberated after injury of the blood vessel. Thromboplastin then catalyzes along with calcium ions the transformation of prothrombin into thrombin.

Thrombin then catalyzes a reaction that makes fibrin from fibrinogen. Fibrin, as an insoluble substance, precipitates to produce a network that traps red blood cells and platelets forming the blood clot and having the hemorrhage.

 


Related Discussions:- How can the blood coagulation process be described

How dna molecules are formed, As a result of DNA replication two DNA molecu...

As a result of DNA replication two DNA molecules come into existence. Why is it not correct to assert that two "new" DNA molecules are created? What is the name given to the proces

What is mutualism, What is mutualism? Mutualism is the ecological inte...

What is mutualism? Mutualism is the ecological interaction in which both participants advantage and that is obligatory for their survival. Mutualism is a harmonious (positive)

Define the term hot water blanching, Define the term Hot water blanching? ...

Define the term Hot water blanching? A appropriate water-blanching process in traditional processing is as follows: The sliced material is placed on a square piece of cl

Properties of cardiac cells, Properties of Cardiac Cells Automaticall...

Properties of Cardiac Cells Automatically: ability of the heart to initiate impulses regularly and spontaneously. Excitability: ability of cardiac cells to respond to

Explain severe acute respiratory syndrome, Severe Acute Respiratory Syndrom...

Severe Acute Respiratory Syndrome (SARS) After travelers' diarrhea, respiratory infection is the most common infectious disease affecting travelers. In the winter of 2003 a ne

Polygonum type - monosporic embryo sacs, Polygonum Type - Monosporic Embryo...

Polygonum Type - Monosporic Embryo Sacs The embryo sac is formed from the chalazal megaspore in the tetrad and is eight-nucleate. The development of the embryo sac begins with

Nutrition, mode of nutrition in tapeworm

mode of nutrition in tapeworm

Bacterial flagella structure and protocol, #qprokroyotic flagella struct...

#qprokroyotic flagella structure and protocoluestion..

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd